a web page with buttons at the bottom

báo cáo khoa học: " The PTI1-like kinase ZmPti1a from maize (Zea mays L.) co-localizes with callose at the plasma membrane of pollen and facilitates a competitive advantage to the male gametophyte" doc

báo cáo khoa học: " The PTI1-like kinase ZmPti1a from maize (Zea mays L.) co-localizes with callose at the plasma membrane of pollen and facilitates a competitive advantage to the male gametophyte" doc

Ngày tải lên : 12/08/2014, 05:20
... Myr:GFP was cloned by in vitro annealing of oligonucleotides Myr -A (5'-P-gatccatgggatgcttttcatgctgctgtgtggcagatgacgacaacgttggcaggaggaagaagcat-3') and Myr-B (5'-Pgatcatgcttcttcctcctgccaacgttgtcgtcatctgccacacagcagcatgaaaagcatcccatg-3') ... (5'-atgcgcgggcgactaaccctggagaacatg-3') and SP3 (5'-ccgagcctggaggcattctgttcaga-3') for ZmPti1b; SP7(5'-cgcaaccaccggcagccactactgacgcta-3') and SP8 (5'-taataaggtggtcacgaccgctg-3') for ZmPti1c; SP12 (5'-ctgcaccaaccaccgaagagccagctcca-3') ... gi|38488409 Nicotiana tabacum gi|38488407 Nicotiana tabacum gi|50909605 Oryza sativa 0.1 ZmPti1c At2 g43230 Arabidopsis thaliana At3 g59350 Arabidopsis thaliana At1 g06700 At2 g30740 Arabidopsis Arabidopsis...
  • 22
  • 321
  • 0
Shaking a box of sand II – at the jamming limit, when shape matters

Shaking a box of sand II – at the jamming limit, when shape matters

Ngày tải lên : 01/11/2013, 08:20
... g, assuming Edwards’ flatness We notice that there is a reasonable congruence of all the numerical results and the (theoretically more accurate) quenched average at the asymptotic density ρ∞ Thereafter, ... p(C) is the probability that the system is in the orientation configuration C in the steady state, and the sum runs over all the 2n configurations of a system of n grains This can be estimated theoretically ... and showing a plot of (minus) the scaling function F (after [34, 35]) The fluctuations are approximately Gaussian, with a definite excess at small values: Wn We recall that non-Gaussianness was...
  • 11
  • 392
  • 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc

Ngày tải lên : 07/03/2014, 12:20
... GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), ... used as a template The following oligonucleotides were used: GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); ... AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A forward (5¢-GCAAGTCATTTTGGATGCTATTAATGCTG ATGGCTCCTTGAATGAAC-3¢), GLU H44 7A, D45 0A FEBS Journal 273 (2006)...
  • 11
  • 548
  • 0
Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx

Hollywood on the Head of a Pin: Montage and Marketing at the Oscars® docx

Ngày tải lên : 07/03/2014, 15:20
... Academy Awards telecast venue itself) with a naturalization of cinema as performance a move moreover appropriate to marketing a commodity that currently counts on a star’s affiliation with a ... what Workman’s Oscar montages tend to communicate is a sort of cult of the cut, ultimately naturalizing quantity (the fast-paced abundance of images) as quality (by, moreover, an Academy-Award ... of the total While this and the other Workman montages ultimately elude any causally or narratively-based rhetorical analysis as persuasive marketing devices, their very anticausality within a...
  • 10
  • 612
  • 0
A Brief Memoir with Portions of the Diary, Letters, and Other Remains, potx

A Brief Memoir with Portions of the Diary, Letters, and Other Remains, potx

Ngày tải lên : 16/03/2014, 01:20
... that surrender, which must have been made on his adoption into the covenant, who shall say that the covenant is not at an 31 end? Who shall say that the way of the Lord is not equal, in that, ... world; at another, filling me with impatience and anxiety about my spiritual progress; at another, with self-confidence, and at another, with despondency Oh, the enemy knows my many weak sides; ... in the conviction that all the followers of Christ are one in Him, and that, by whatever name designated, those who have attained to the closest communion with Him are the nearest to one another;...
  • 95
  • 517
  • 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc

Ngày tải lên : 23/03/2014, 09:20
... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG GGGCGGATCCTCTGCTTTTCTTTATC CTGGACACAGCCACGCAGTATACAGCATACTATAACGG CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG ... CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAG CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGG Table Plasmids used in this study Plasmid Description Source YCplac111 pGEX5X-1 ... membrane association and ATPase activity of Vps4p at the yeast multivesicular body Proc Natl Acad Sci USA 103, 6202–6207 Amerik AY, Nowak J, Swaminathan S & Hochstrasser M (2000) The Doa4 deubiquitinating...
  • 14
  • 362
  • 0
peachpit press visual quickproject guide building a web site with ajax (2008)

peachpit press visual quickproject guide building a web site with ajax (2008)

Ngày tải lên : 27/03/2014, 13:38
... start a PHP page 43 44 45 46 47 49 validate the form data update the database report any errors test the non-Ajax version extra bits adding records via Ajax what we’ll add the Ajax elements apply ... repeated Ajax is one way to create Rich Internet Applications (RIAs): Web sites that behave more like desktop applications With an Ajax-enabled application, after the initial loading of the page, ... database—I’m using the name ajax—in the Create new database box, and then click Create (You can ignore the Collation menu; see extra bits on page 9.) The resulting page should show that the database...
  • 168
  • 575
  • 0
apress dom scripting web design with javascript and the document object model 2nd ed

apress dom scripting web design with javascript and the document object model 2nd ed

Ngày tải lên : 28/04/2014, 16:20
... zero That was a fairly long-winded way of populating an array You can take a shortcut by populating your array at the same time that you declare it When you are populating an array in a declaration, ... look at a more readable way of populating arrays, and then move on to the preferred method, storing data as an object Associative arrays The beatles array is an example of a numeric array The ... "happy"; age = 33; When a variable has been assigned a value, we say that the variable contains the value The variable mood now contains the value “happy.” The variable age now contains the value...
  • 337
  • 1K
  • 0
apress dom scripting web design with javascript and the document object model

apress dom scripting web design with javascript and the document object model

Ngày tải lên : 28/04/2014, 16:20
... "happy"; age = 33; When a variable has been assigned a value, we say that the variable contains the value The variable mood now contains the value “happy” The variable age now contains the value ... created automatically Each index is still associated with a specific value So a numeric array is really just another example of an associative array Using associative instead of numeric arrays ... whenever you want to carry out the same action more than once The real power of functions is that you can pass data to them and then have them act on that data When data is passed to a function,...
  • 345
  • 1.6K
  • 2
báo cáo khoa học: "Primary malignant mixed müllerian tumor of the peritoneum a case report with review of the literature" doc

báo cáo khoa học: "Primary malignant mixed müllerian tumor of the peritoneum a case report with review of the literature" doc

Ngày tải lên : 09/08/2014, 01:24
... chemotherapy and irradiation with various survival outcomes Ko et al [19] reported on a patient that was treated with optimal tumor debulking and a combination of chemotherapy with Ifosfamide and ... Takeda A, Fukami H, Yamada C, Matsuyama M: Characteristics of cell lines established from mixed mesodermal tumor of the human ovary: carcinomatous cells are changeable to sarcomatous cells Cancer ... 400) Page of examination of the uterus and adnexae Furthermore, absence of calretinin expression suggested that the tumor was of Müllerian rather than pure mesothelial origin [6] A search of the...
  • 4
  • 461
  • 0
Báo cáo y học: "A successfully thrombolysed acute inferior myocardial infarction due to type A aortic dissection with lethal consequences: the importance of early cardiac echocardiography" ppsx

Báo cáo y học: "A successfully thrombolysed acute inferior myocardial infarction due to type A aortic dissection with lethal consequences: the importance of early cardiac echocardiography" ppsx

Ngày tải lên : 10/08/2014, 09:22
... latest data, surgery is the best option with a mortality rate of to 21% for type A AAD and medication only is the best choice for an uncomplicated type B AAD with a mortality rate of approximately ... of a valved-graft A coronary artery bypass grafting with a saphenous vein graft anastomosed in the right coronary artery at the level of the crux was also done The patient was rewarmed and weaned ... informed and an emergent replacement of the aortic root and ascending aorta was decided The patient was transported in the operating room in a critical state The right axillary artery was cannulated...
  • 6
  • 335
  • 0
Study of technical feasibility and the payback period of the invested capital for the installation of a grid connected photovoltaic system at the library of the technological federal university of paraná

Study of technical feasibility and the payback period of the invested capital for the installation of a grid connected photovoltaic system at the library of the technological federal university of paraná

Ngày tải lên : 09/09/2015, 10:32
... systems in Brazil 4.1 System of Federal University of Santa Catarina Situated at the Solar Energy Laboratory – LABSOLAR, at the UFSC (Federal University of Santa Catarina), there is the first Grid-connected ... result is used, although Fusano [17] has found a difference of 5,5% between annual average daily irradiation obtained at the weather station INMET and database SWERA To conclude, this paper considered ... capital invested in the project n ∑ RFATi (2) i where i is the year; RFAT the annual financial return of the year i Logically, the weekly financial return was calculated, as shown in the Equations...
  • 12
  • 431
  • 0
Tutorial 1 developing a web page

Tutorial 1 developing a web page

Ngày tải lên : 30/05/2016, 00:04
... List" as an h2 heading, centered horizontally on the page What is a presentational attribute?What is a reason for using presentational attributes? What is a reason for avoiding them? Specify the code ... markup tag using the syntax where attributel, attribute2, etc are the names of attributes associated with the element and valuel, value2, etc are the values of those attributes You can list attributes ... to create other markup languages that are tailored to specific tasks and are simpler to use and maintain HTML is one of the languages created with SGML In the early years after HTML was created,...
  • 60
  • 715
  • 0
Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3

Incorporating english cultural elements into english training with the comparing - contrasting approach: A case of tourism students at haiphong community college part 3

Ngày tải lên : 07/11/2012, 15:06
... is aimed at collecting both quantitative and qualitative data to make use of analytical and exploratory- interpretive paradigms in applied linguistics The quantitative and qualitative data collected ... of adequate training HCC teachers may not have been adequately trained in the teaching of culture and, therefore, they not have strategies and clear goals that help them to create a viable framework ... content themselves with the thought that Tourism students will be exposed to cultural material later, after they have mastered the basic grammar and vocabulary of the language The last one is the lack...
  • 40
  • 644
  • 1
Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Báo cáo khoa học: Interactions of HIPPI, a molecular partner of Huntingtin interacting protein HIP1, with the specific motif present at the putative promoter sequence of the caspase-1, caspase-8 and caspase-10 genes pdf

Ngày tải lên : 07/03/2014, 10:20
... Allowing two substitutions Allowing two substitutions Allowing one substitution AAAGACATG AAAGACAGG AAAGAGATT AAAGAGATG AAAGACATA AAAGACATA AAAGAGAAC AAAGACATA AAAGAAAAG AAACAGATG AAAGAAAAG AAAGAAAAG ... putative HIPPI-binding motif and its mutants ND, not determined Fluorescence quenching Sequence EMSA Result Average Kd (nM) AAAGACATG AGAGACATG AAGGACATG AAATACATG AAAGCCATG AAAGAGATG AAAGACCTG ... (IDT, Coralville, IA, USA) In addition, oligonucleotides, namely AGAGACATG (P2), AAGGACATG (P3), AAATACATG (P4), AAAGCCATG (P5), AA AGAGATG (P6), AAAGACCTG (P7), AAAGACACG 3896 Cloning of the Hippi...
  • 14
  • 393
  • 0
Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx

Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx

Ngày tải lên : 31/03/2014, 07:20
... subjects (CA genotype) was PCR amplified using a forward primer starting at nucleotide )622 (5¢-CCAAGACATACTAAGAATGG-3¢) and the same reverse primer ending at nucleotide +74 (5¢-GGCA GAGAAAACTCGAGAAC-3¢) ... demonstrate that the )1C A mutation at the transcriptional initiation site is causative, which regulates b2GPI gene expression at the transcriptional level that ultimately affects b2GPI plasma levels ... polymerase (Stratagene, La Jolla, CA, USA) to eliminate the possibility of PCRinduced mutations The reactions were then denatured at 95 °C for and gradually reannealed by decreasing the temperature to...
  • 9
  • 462
  • 0
building web applications with sasintrnet® a guide to the application dispatcher

building web applications with sasintrnet® a guide to the application dispatcher

Ngày tải lên : 01/06/2014, 01:15
... and is a set of Java classes that can be used to create Java applets, JSP, and Java applications that communicate with a SAS data server (either SAS/SHARE or the SAS Scalable Performance Data ... that session, create data sets, access existing SAS data, run SAS programs to analyze SAS data, and retrieve the results The Java components in SAS AppDev Studio can be used to create applications ... dynamic applications that can access the power of SAS (the Application Server) from a Web browser The gateway also provides the capability to run any SAS program that can be executed in batch...
  • 377
  • 210
  • 0
Báo cáo lâm nghiệp: "Spatio-temporal pattern of bog pine (Pinus uncinata var. rotundata) at the interface with the Norway spruce (Picea abies) belt on the edge of a raised bog in the Jura Mountains, Switzerland" doc

Báo cáo lâm nghiệp: "Spatio-temporal pattern of bog pine (Pinus uncinata var. rotundata) at the interface with the Norway spruce (Picea abies) belt on the edge of a raised bog in the Jura Mountains, Switzerland" doc

Ngày tải lên : 08/08/2014, 01:21
... 1880 and 1995 were used as descriptors for calculating the Euclidean distance matrix comparing all the individual trees Prior to the analysis, the data were standardised (zero mean and unit variance) ... range, mean annual precipitation is about 1500 mm with a peak in summer Mean annual temperature is about 5.5 °C; the mean of the coldest month (January) is ca –4 °C, and the mean of the warmest ... approximately along the pine-spruce contact zone and along the main limit between undergrowth vegetation patches (Fig 1) It is also at this interface that the mean annual apical growth was highest...
  • 10
  • 277
  • 0
Báo cáo y học: "A web tool for finding gene candidates associated with experimentally induced arthritis in the rat" docx

Báo cáo y học: "A web tool for finding gene candidates associated with experimentally induced arthritis in the rat" docx

Ngày tải lên : 09/08/2014, 06:22
... is, the more likely it is to be a gene candidate The application can be accessed from the RatMap home page [7] or directly at http://ratmap.org/cgc Comparison of manual evaluation with CGC ranking ... rated higher than a gene that is annotated for the same term together with additional Gene Ontology terms with lower scores Furthermore, in contrast to CGC, the GD2 database is a static database ... Arthritis Research & Therapy Vol No Andersson et al combined with the retrieval of potential candidate genes found in different databases Information about RA and related genome data is available...
  • 8
  • 415
  • 0