a total transfer and b critical load transfer

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

... Bacterium Bacterium Bacterium Bacterium Yeast Bacterium Archaea Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Plant Plant a- Amylase Barley ... 128146 Plant Plant Plant Plant Plant Plant Mammal Bacterium Mold Yeast Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium Bacterium ... invariant Y51AMY2 and Y82TAA are at subsite )1 as are H92AMY2 and H122TAA; M52AMY2 (M53AMY1) and W83TAA are at subsite )2; T94AMY2 (C95AMY1) at subsite-5 [38,45]; and Y104AMY2 at subsite-6 (B) Stereo...

14
557
0

báo cáo hóa học: " Ting JY: Letter to the Editors: The potential role of prehospital thrombolysis and time-critical stroke transfers in the northern Norway aeromedical retrieval system." potx

Danh mục: Hóa học - Dầu khí

...

1
366
0

A Heat Transfer Textbook Third Edition by John H Lienhard IV and John H Lienhard V_1 ppt

Danh mục: Điện - Điện tử

...

2
259
0

A Heat Transfer Textbook Third Edition by John H Lienhard IV and John H Lienhard V_3 ppt

Danh mục: Điện - Điện tử

...

6
316
0

Báo cáo y học: "EXACKTE2: Exploiting the clinical consultation as a knowledge transfer and exchange environment: a study protocol" pptx

Danh mục: Báo cáo khoa học

... JG is a Tier Canada Research Chair in Health Knowledge Transfer and Uptake and leads Knowledge Translation Canada (KT Canada), a national research network in Canada FL, ML and MO are members of ... http://www.implementationscience.com/content/4/1/14 Table 1: Measurements and variables assessed Type of variable Variables assessed Scale or subscale Measures, Author, Year Number of items Timeframe Entry After ... question, and is referred to as a measure of self-efficacy As stated by Makoul and Clayman, 'the rationale for incorporating a patient's efficacy expectation parallels the argument for discussing patient...

11
369
0

báo cáo khoa học: " EXACKTE2: Exploiting the clinical consultation as a knowledge transfer and exchange environment: a study protocol" docx

Danh mục: Báo cáo khoa học

... JG is a Tier Canada Research Chair in Health Knowledge Transfer and Uptake and leads Knowledge Translation Canada (KT Canada), a national research network in Canada FL, ML and MO are members of ... http://www.implementationscience.com/content/4/1/14 Table 1: Measurements and variables assessed Type of variable Variables assessed Scale or subscale Measures, Author, Year Number of items Timeframe Entry After ... question, and is referred to as a measure of self-efficacy As stated by Makoul and Clayman, 'the rationale for incorporating a patient's efficacy expectation parallels the argument for discussing patient...

11
500
0

Báo cáo sinh học: " genetic response possible in dairy cattle improvement by setting up a multiple ovulation and embryo transfer (MOET) nucleus scheme" ppt

Danh mục: Báo cáo khoa học

... scheme, animals are selected after the first lactation Males are evaluated on their full sibs’, half sibs’ and dam’s records; females are evaluated on the same information plus their own lactation ... investment appraisal Anim Breed Abstr 48, 499-505 Brascamp E.W (1978) Methods on economic optimisation of animal breeding plans Res lnst Anim Husbandry, Zeist, the Netherlands Burrows P.M (1984) Inbreeding ... and so is taken to have a heritability value of 0.25 and a repeatability of 0.5 For simplicity, genetic gain is expressed in standard deviation units (ap) Progeny testing scheme A conventional...

15
328
0

Palladium (II) catalyzed 5 endo epoxynitrile cyclizations total syntheses of enokipodins a and b

Danh mục: Kỹ năng đọc tiếng Anh

... of DIPEA or absence of base afforded no cyclization products (Table 1, entries 13 and 14) This way, it was established that both base nature and metallic counter-ion are essential to achieve good ... Nuria Esterau, (a) Ishikawa, N K.; Yamaji, K.; Taharab, S.; Fukushi, Y.; Takahashi, K Phytochemistry 2000, 54, 777; (b) Ishikawa, N K.; Fukushi, Y.; Yamaji, K.; Tahara, S.; Takahashi, K J Nat Prod ... acquiring spectral data Supplementary data Scheme Preparation of precursor Supplementary data (experimental procedures and spectral data for compounds 1–2, 7, 8a b, 13) associated with this article...

5
485
0

600 sentences of certificate A and B

Danh mục: Cao đẳng - Đại học

... father a than b as c but d and > a 48 I am teacher a the b a c an d no article > b 49 My uncle is good engineer a the b a c an d no article > b 50 That is eraser a the b a c an d no article ... the b a c an d no article > b 55 That is a bag It is on table a the b a c an d no article > a 56 We are in same class a the b a c an d no article > a 57 Your book is the desk a at b over ... pounds from a bank a crime b criminal c criminally d criminality > b 178 your own business can cause a lot of financial worries a Manage b Managing c Manager d Manageable > b 179 The surgeons...

280
884
3

Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf

Danh mục: Ngân hàng - Tín dụng

... ns Romania Poland India France Germany Portugal Brazil Hong Kong Ukraine Other USSR/Russia Japan China Vietnam Nigeria Colombia Thailand Nicaragua Peru Ecuador Trinidad and Tobago Guyana/British ... Nigeria Ireland Haiti Egypt/United Arab Rep Iraq Honduras Nicaragua South Africa Portugal Turkey France Thailand Trinidad and Tobago Guyana/British Guiana Syria Jordan All other foreign-born U.S.-born ... Mexico India Korea Cuba China Vietnam Canada Iran Philippines Poland Italy Colombia Taiwan Germany El Salvador Pakistan England Greece Brazil Israel/Palestine Dominican Republic Jamaica Other USSR/Russia...

37
436
0

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Danh mục: Báo cáo khoa học

... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and annealed to a prepared ... for LlCBP3 3A at pH 6.0 (A, B) Binding of LlCBP3 3A visualized by SDS-PAGE (A) LlCBP3 3A present in the supernatant after 24 h of incubation with a- chitin (lane 2), b- chitin (lane 3), Avicel (lane ... incubation FEBS Journal 276 (2009) 24022415 ê 2009 The Authors Journal compilation ê 2009 FEBS G Vaaje-Kolstad et al Degradation of a- and b- chitin The degradation rates of a- and b- chitin were assayed...

14
683
0

Báo cáo khoa học: Coordination of three and four Cu(I) to the a- and b-domain of vertebrate Zn-metallothionein-1, respectively, induces signiﬁcant structural changes doc

Danh mục: Báo cáo khoa học

... distorted chair The C-terminal a- domain is characterized by an adamantane-like four-metal cluster Solution structures of 113 Cd-substituted Cd7MT-2 from rabbit, rat and human are available and revealed ... (Tubingen, Germany), and all ¨ other chemicals were from Merck (Darmstadt, Germany) Synthesis of the individual a- and b- domains The individual a- and b- domains (KSCCSCCPVGCSKCA QGCVCKGAADKCTCCA ... Zn4aMT and Zn3bMT with those observed for Cd7MT [20] Presence (+) or absence (–) of NOEs is indicated b- Domain Proton Asn (a) Asn (a) Asn (b) Cys (a) Cys (b) Asn 23 (b) a- Domain Lys (NH) Lys (a) ...

14
485
0

Báo cáo khoa học: Mutual effects of proton and sodium chloride on oxygenation of liganded human hemoglobin Oxygen afﬁnities of the a and b subunits potx

Danh mục: Báo cáo khoa học

... (3) and (4), the dissociation rate constant, k, and the O2 afﬁnity, K, can be derived for both the a and b subunits from the averaged parameters of HbA oxygenation (Table 1, Average) The association ... oxygenation parameters in the salt-free buffers (Table 1, Average) can be considered as follows The BR rate constant for the a subunits within triliganded HbA and the BR quantum yield for the a subunits ... ! ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À a; bO2 ÞðaO2 ; bO2 Þ þ O2 ka À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! hv ð1Þ ðaO2 ; bO2 ÞðaO2 ; bO2 Þ À ðaO2 ; b ðaO2 ; bO2 Þ þ O2 ! kb À ðaO2 ; bO2 ÞðaO2 ; bO2 Þ ! where (aO2,...

11
577
0

Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new afﬁnity label for probing the structure and function of glutathione transferases potx

Danh mục: Báo cáo khoa học

... Met121Ala mutation, 5¢-ATCAGTCCGGCACTTGGGGGAACC-3¢ and 5¢-GAGGACGTCGAAGAGGATGGGTTACAG-3¢ The mutation (codon underlined above) was confirmed by DNA sequencing on Applied Biosystems Sequencer 37 3A ... performed as described [14] Expression of mutants was also performed as described by Labrou et al [14], but purification was achieved by using the affinity adsorbent Cibacron blue 3GA–Sepharose, adsorbed ... spectra of native and mutated enzyme (data not shown) indicates the absence of any structural perturbation caused by the mutation Aminoacid analysis of the SDTG-modified Phe51Ala mutant and determination...

9
556
0

Báo cáo Y học: A polymer with a backbone of 3-deoxy-D-glycero -D-galacto -non-2ulopyranosonic acid, a teichuronic acid, and a b-glucosylated ribitol teichoic acid in the cell wall of plant pathogenic Streptomyces sp. VKM Ac-2124 pdf

Danh mục: Báo cáo khoa học

... scabies, S acidiscabies, S caviscabies, S setonii, S turingiscabies, S europaeiscabiei and S reticuliscabiei, where cell wall anionic polymers have not been analysed yet, will testify to or against ... ribitol monophosphates and bisphosphates, anhydroribitol phosphate, anhydroribitol, ribitol, inorganic phosphate and glucose The amount of the latter exceeded considerably that bound to ribitol ... S .A & Tiedje, J.M (2001) Agreia bicolorata gen nov., sp nov to accommodate actinobacteria isolated from narrow reed grass infected by nematode Heteroanguina graminophila Int J Syst Evol Microbiol...

6
561
0

The a and b adapters are used as priming sites for both amplification

Danh mục: Tin học

... the wells not allow more than one ssDNA bead to be loaded into a well • Enzyme beads and packing beads are added Enzyme beads containing sulfurase and luciferase, and packing beads used only ... are broken, and the beads are released • Enrichment beads are added (containing biotin); these attach to DNA rich beads only • A magnetic field filters all DNA rich beads from empty beads, and ... The B adapter contains a 5’ biotin tag used for mobilization • The beads are magnetized and attract the biotin in the B adaptors Filtering the Mess • There are four adaptor combinations that are...

19
390
0

Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from ﬂax – linolipins A and B docx

Danh mục: Báo cáo khoa học

... flax leaves Galactolipids were separated and purified as described in Materials and methods EDE content was measured by UV absorbance of MGDG and DGDG fractions at 267 nm Average values and standard ... galactolipid molecular species from flax leaves Total galactolipids were extracted from flax leaves, separated and purified as described in Materials and methods UV chromatograms (267 nm) of galactolipids ... diglyceride, from Arabidopsis thaliana J Biol Chem 276, 12832–12838 42 Hisamatsu Y, Goto N, Hasegawa K & Shigemori H (2003) Arabidopsides A and B, two new oxylipins from Arabidopsis thaliana Tetrahedron...

10
387
0

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Danh mục: Báo cáo khoa học

... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... Hsp90 clients and Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a and Hsp9 0b Whether Hsp9 0a or Hsp9 0b is expressed ... staining revealed almost instant loss of any actin organization following Hsp90 inhibitor treatment; data not shown) After h, many of these cells displayed an apparent arrest of DNA and vacuolar...

11
427
0

Báo cáo khoa học: Identiﬁcation of a glycosphingolipid transfer protein GLTP1 in Arabidopsis thaliana ppt

Danh mục: Báo cáo khoa học

... (5¢-AACGATCTAGATTAAGAATGTAATCACATTAGG GT-3¢) and 21360PRNNBAM (5¢-GGAAGGATCCACTT TATTACAAGACCAGCGTTAT-3¢) The promoter fragments obtained were incubated with restriction enzymes XbaI and BamHI and ... The cDNA was ampliﬁed from U66003 using primers U660035Eco2 (5¢-AATAGA GAATTCAGAGAAAGAGATACGAGATGGA-3¢) and U660033Not (5¢-TCATAAGGCGGCCGCCTACATCG ATCTTAATCTGCTCAA-3¢) A fragment carrying At3g21260 ... (5¢-AGACTGCTCTAGAATG GGTTTCTAAACCAACACGT-3¢) and GLTP1PRONBAM (5¢-CTCCTTGGATCCGCCTGAGAATTGAAAAA GGTGGG-3¢) A 1.3 kb fragment carrying the At1g21360 promoter was ampliﬁed using primers 21360PRUXBA...

17
300
0

Báo cáo khoa học: Dynamics of a-synuclein aggregation and inhibition of pore-like oligomer development by b-synuclein doc

Danh mục: Báo cáo khoa học

... with biochemical and ultrastructural analysis, that 1870 a- syn can arrange into homodimers that can adopt nonpropagating and propagating conformations The evidence predicts that propagating a- syn ... (1998) Abnormal accumulation of NACP ⁄ a- synuclein in neurodegenerative disorders Am J Pathol 152, 367–372 Wakabayashi K, Matsumoto K, Takayama K, Yoshimoto M & Takahashi H (1997) NACP, a presynaptic ... initial and end stages of ﬁbrillation have been characterized in some detail and recent studies have shown that early stage oligomers are globular structures with variable height (2–6 nm) that after...

16
284
0