a topdown approach featuring the internet 4th edition

Developing Writing Skills in a Foreign Language via the Internet.doc

Developing Writing Skills in a Foreign Language via the Internet.doc

Ngày tải lên : 06/09/2013, 05:10
... learners can model their own work in this area of academic writing. The Internet The Internet has made many opportunities available to both learners and educators that were not feasible in the ... features of academic essays (topic sentences, paragraphs, conclusions), but rather the differences, namely connectors and organization, which set compare/contrast essays apart from other academic ... a few. And, at our very fingertips are assorted, authentic materials whose access are not limited to either temporal or spatial constraints, for the Internet is easily accessed 24 hours a day...
  • 5
  • 576
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Ngày tải lên : 07/03/2014, 09:20
... CCCCATGTCGCCTTTAGT OMCB-KO-R TCGCTAGAACACATTGAC OMCA-F ATGATGAAACGGTTCAAT OMCA-R TTAGTTACCGTGTGCTTC OMCB-F CTGCTGCTCGCAGCAAGT OMCB-R GTGTGATCTGCAACTGTT OMCA-PBAD-F CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC OMCA-PBAD-R ... CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC OMCA-PBAD-R TTAGTTACCGTGTGCTTC OMCB-PBAD-F CACCGAGGAATAATAAATGATG AACGCACAAAAATCA OMCB-PBAD-R TTACATTTTCACTTTAGT Shewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al. 3736 ... used as a positive control to display omcA (lane 1) and omcB (lane 6). DNA standards are indicated at the left and right of the agarose gels. (B) Visualization and separation of high molecular mass...
  • 11
  • 731
  • 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

Ngày tải lên : 08/03/2014, 18:20
... of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) ... Vowel-Harmony The first rule indicates that a word consists of an optional prefix followed by a Vowel- Harmony-Domain; the second claims that a Vowel-Harmony-Domain is a string analyzable as a ... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central to the task of a morphological analyzer and, hence, have incorporated...
  • 8
  • 522
  • 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Ngày tải lên : 15/03/2014, 10:20
... Tirana, Albania; e-mail: kadareja@yahoo.com Working PaPer SerieS no 1150 / January 2010 Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area by ... motif taken from the €500 banknote. DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA 1 by Lorenzo Cappiello 2 , Arjan Kadareja 3 , Christoffer ... intermediation through the impact it may have on the pricing, management and perception of risk by …nancial intermediaries. 6 All in all, the fact that monetary policy can a ect the balance sheets...
  • 30
  • 911
  • 0
A Brief History of the Internet docx

A Brief History of the Internet docx

Ngày tải lên : 22/03/2014, 22:20
... was a good idea. That watershed event caused a ripple effect. With others finally interested in Etext, a "Mass Marketing Approach, " and such it was, was finally appropriate, and the ... other Shakespeare professors believe that the way a person should act to be a great Shakespeare professor is to teach as many people as possible about Shakespeare in as complete a manner as ... knowledge in the hands of the few and away from the minds of the many. I predict that in the not-too-distant-future that all materials will either be circulating on the Internet, or that they will...
  • 98
  • 517
  • 0
Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt

Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt

Ngày tải lên : 23/03/2014, 14:20
... Italian), pastarant (pasta + restaurant) and peatza (pizza + eat). These three suggestions are amusing and have a nice ring to them. As a matter of fact, it turns out that the name Eatalian is actually used ... eating), pizza and pasta (which are found AtLocation restaurant) to generate an appropriate name. The three “palatable” neolo- gisms generated are eatalian (from the combination of eat and Italian), ... modern eatalian italian, eat dusta pasta, dust pastarant restaurant, pasta hometess hostess, home peatza pizza, eat shampoo smooth bright soft volumizing hydrating quality fragrinse fragrance,...
  • 9
  • 518
  • 0
Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

Ngày tải lên : 24/03/2014, 03:20
... Ideally, we would like to look at TroFi as a first step towards an unsupervised, scalable, widely applicable approach to nonliteral language processing that works on real-world data from any domain ... for each target word. It also provides the feedback set sizes for each target word. The to- tals across all words are given at the bottom of the table. absorb assault di e drag drown Lit Target ... for av- erage recall. For overall performance, we take the f-score of average precision and average recall. We calculated two baselines for each word. T he first was a simple majority-rules baseline....
  • 8
  • 447
  • 0
Towards a safer use of the Internet for children in the EU – a parents’ perspective ppt

Towards a safer use of the Internet for children in the EU – a parents’ perspective ppt

Ngày tải lên : 29/03/2014, 19:20
... authorities 92 90 88 88 87 78 78 77 75 75 74 73 72 70 70 67 66 65 64 63 63 61 58 57 56 51 51 49 0 25 50 75 100 PT MT IE EL CY UK ES SI PL LT SE BE FR FI EU27 LU RO HU BG IT DE EE NL SK LV AT CZ DK The previous charts showed that in almost all Member States – similar to the results obtained for the EU27 overall – a large majority of the parents each time agreed that the measure ... of the parents in Bulgaria (7%) and Lithuania (8%), and one-tenth of the parents in Greece and Latvia (both 11%) answered that their child was not allowed to download or play music, films and ... of 10 parents in all educational groups answered that they always or very frequently stayed nearby when their child used the Internet) . Parents with a lower level of educational attainment...
  • 154
  • 399
  • 0
Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx

Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx

Ngày tải lên : 31/03/2014, 04:20
... traditional ASR applications (e.g. dictation, database access), but also embraces multilingual speech input, medical (speech therapy) and teaching (computer-assisted language learning) applications. ... (non-spontaneous voicing) and N (nasality), and the resonance elements A (low), I (palatal), U (labial) and R (coronal). These elements are phonologically active - they can spread to neighbouring ... has been detected in both the initial fricative and the final plosive at Stage 2. Again, it may be possible to identify a unique word candidate at the end of Stage 2, but if several candidates...
  • 5
  • 337
  • 0
jesus our priest a christian approach to the priesthood of christ apr 2010

jesus our priest a christian approach to the priesthood of christ apr 2010

Ngày tải lên : 10/06/2014, 21:42
... use of sacrificial imagery ‘implies a replacement of ritual sacrifice and indicates an assumption that the death of Jesus had been a final sacrifice to end all sacrifices’ (Romans 9 16 (Dallas, Tex.: ... recalls what Paul has said about baptism as participating in the death and resurrection of Christ (Rom. 6: 1–14). In particular, talk of a ‘living sacrifice’ echoes the earlier call to be ‘dead ... bringing about a new covenant (2, 5, and 6)? What does the language of sacrifice mean and how can it be justified and maintained (4)? What more did New Testament Christians and their successors maintain,...
  • 322
  • 436
  • 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

Ngày tải lên : 18/06/2014, 15:20
... 360(9331):427-435. 14. Miyamoto K, Nishigami K, Nagaya N, Akutsu K, Chiku M, Kamei M, Soma T, Miyata S, Higashi M, Tanaka R, Nakatani T, Nonogi H, Take- shita S: Unblinded pilot study of autologous transplantation ... Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients with limb ischaemia by autologous transplantation of bone- marrow cells: a pilot study and a randomised controlled trial. Lancet ... pathological neovascularization. Circ Res 1999, 85(3):221-228. 13. Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K,...
  • 9
  • 773
  • 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc

Ngày tải lên : 21/06/2014, 19:20
... group delay was proposed that is based on the Remez exchange algorithm. With the mentioned approaches a filter group 2 EURASIP Journal on Advances in Signal Processing delay can always be obtained that ... in the passband but also in the transition band. The mean value of the group delay ranges below that of linear-phase filters of the same length. The observed overall signal delay lies within the ... in the passband and the transition bands. As the objective function to be minimised we adopt a particular representation of the group delay [20], while the stopband magnitude specifications of the...
  • 13
  • 623
  • 0
Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx

Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx

Ngày tải lên : 22/06/2014, 06:20
... DSP cores for the control-oriented functionality (an ARM for the signalling part and a StarCore for the multimedia part). It features several hardware accelerating units (ASICs), for the more data-oriented ... for ρ and r loc is depicted. The rank levels are annotated at the bottom of the graphic. The fundamental idea of the algorithm explained in Section 5 is that, in general, a local optimal solution, ... research groups in the field, namely, Kalavade and Lee [8], Wiangtong et al. [9], and Chatha and Vemuri [10]. The fundamental idea behind the presented strategy is the exploitation of distinct graph...
  • 13
  • 310
  • 0

Xem thêm