a the cover page of your proposal must contain the notice below please cut and paste
FINANCIAL ASSISTANCE FUNDING OPPORTUNITY ANNOUNCEMENT - Small Business Innovation Research (SBIR) pdf
... outlined below: (1) The Cover Page of your proposal must contain the notice below (please cut and paste) : “Pages [ _] of this document may contain trade secrets or commercial or financial information ... the availability of appropriated funds and this FOA does not obligate DOE to make any awards under Phase I or Fast-Track E ANTICIPATED AWARD SIZE The average Phase I award size for the SBIR and ... technical aspects of the grant application and be capable of leading the 15 research effort DOE's evaluation of the grant application is critically dependent on the qualifications of the PI Any changes...
- 62
- 761
- 0
Báo cáo y học: "A plague on five of your houses – statistical reassessment of three pneumonic plague outbreaks that occurred in Suffolk, England, between 1906 and 1918" pdf
... Medical History 1970, 14:63-74 10 Ratsitorahina M, Chanteau S, Rahalison L, Ratsifasoamanana L, Boisier P: Epidemiological and diagnostic aspects of the outbreak of pneumonic plague in Madagascar ... in the Black Sea and the Americas contained plague-infected rats which lead to enzootic rat-flea plague cycles All of these outbreaks are particularly well documented and have been described as ... in the autumn of 1910 of four deaths at Freston near Ipswich, from a rapidly fatal and infectious malady diagnosed as pneumonic plague, and upon the prevalence of plague in rodents in Suffolk and...
- 10
- 272
- 0
A cross national study of senior volunteerism in two non government organizations in singapore and p r china
... the two Organizations 108 Table 6-3 Means and Standard Deviations of Items of Self-perceived Social Acceptance of Volunteer Work by the Respondents in LB and JY 110 Table 6-4 Means and Standard ... two Organizations 69 Table 5-6 Means and Standard Deviations of Items of Views on Volunteer Work by the Respondents in LB and JY 70 Table 5-7 Means and Standard Deviation of Items of Reasons for ... large number of couples may have to rear their own child and look after their two pairs of parents and four pairs of grandparents In addition, with economic development and social changes in the...
- 184
- 471
- 0
– ANSWERS – Set 26 (Page 66) 390. a. Since one-half of the four children are girls, two must potx
... two largest theaters Also, the theater never shows a foreign film in the largest theater Theaters and must show the movies that are rated G and PG, so the movies that are there must stay there The ... logical choice is to put Mist in theater and Fly in theater 422 a “Honey” and “Sittin’ on the Dock of the Bay” are either and or and The Rascals appear on the list right after Otis Redding, who cannot ... states that threading a needle involves motor skill The other choices are not in the paragraph 477 a The paragraph states that Mars once had a thick atmosphere, but that it was stripped away The...
- 22
- 356
- 0
the great work of your life a guide for the journey to your true calli stephen cope
... the actions of Mahatma Gandhi and Martin Luther King Jr., and Nelson Mandela And it has inspired generations of Americans to be themselves The fact that Thoreau’s trek to Walden was such an altogether ... teaching to Arjuna is simple and direct: “Arjuna, look to your dharma.” Look to your dharma! And what is this dharma that can save Arjuna? The Sanskrit word “dharma,” as used in the Bhagavad Gita, is ... Arjuna a visceral sense of foreboding The narrator has already told us that the forces of light and the forces of darkness are about to collide, and that this battle will tear the fabric of the...
- 192
- 697
- 0
Báo cáo y học: "The appropriateness of single page of activation of the cardiac catheterization laboratory by emergency physician for patients with suspected ST-segment elevation myocardial infarction: a cohort study" doc
... the absence of a culprit coronary artery, absence of significant coronary artery disease and negative cardiac biomarkers A culprit coronary artery was defined as the presence of an acute total ... Association, Canadian Cardiovascular Society: ACC/AHA guidelines for the management of patients with ST-elevation myocardial infarction; a report of the American College of Cardiology/American ... managed the data and critical revisions to the manuscript CSY conceived the research and drafted the manuscript Each authors has read and approved the final manuscript Competing interests The authors...
- 6
- 232
- 0
Law and governance in golf courses a cross national comparison of environmental frameworks, industry norms and sustainability practices in the philippines, thailand, viet nam and singapore title page
... re-arranged and grammatical organization has been improved The comparative arrangement enhanced the evaluation and critical analysis of the issues, laws and regulations Referencing has been-re-arranged ... Thailand 20 Raweewan Bhuridej, Ministry of Natural Resources and Environment, Thailand 21 Supanon Sirichuaychoo, Department of Agriculture, MOAC, Thailand 22 Margaret Yoovatana, Department of Agriculture, ... (1998) comparative environmental law approach and Maria Francesch-Huidobro environmental governance theory Part III also contains the definition of terms, elaboration and explanation of the framework,...
- 30
- 491
- 0
The chart below shows the sleep patterns of people in five different occupations according to a Canadian study
... wake at a. m., but nap for two hours or so in the early afternoon Thus the influence on one's sleep pattern is worthy of consideration when choosing an occupation ...
- 2
- 1,418
- 3
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
... (MedCalc Software, Mariakerke, Belgium) statistical software was used for all statistical analyses Categorical data are presented as absolute and relative frequencies, continuous variables as median ... Edita Lukić, Goran Madžarac and Alen Švigir for their help in the acquisition and arrangement of the data Page of Author Details 1Department of Intensive Care Medicine, University Hospital Centre ... shock); ii) acute coronary syndrome (myocardial infarction and unstable angina); and iii) all other admission diagnoses This division was made due to the fact that sepsis and acute coronary syndromes...
- 8
- 656
- 1
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"
... critically revising the draft JG made substantial contributions to the data analysis GB was substantially involved in the analysis, interpretation and drafting the manuscript Acknowledgements To the ... physician rounds and adverse drug events in the intensive care unit JAMA 1999, 282:267-270 British Medical Association and the Royal Pharmaceutical Society of Great Britain: British National Formulary ... for the error rate analysis The patient outcome from each error were assigned by the pharmacist and the ICU clinical director, according to an adapted scale [9-11] Minor errors were classified as...
- 6
- 525
- 0
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"
... confirmation of nutrient levels and absence of heavy minerals and other contaminating ingredients Calcium, magnesium and other minerals were validated by Advanced Labs, Salt Lake City, UT The supplement ... data, some of the explanation may be attributed to what appears to be optimal levels of vitamin D3 (1,000 IU) and calcium (750 mg) that were in the Plan version of AC An additional benefit may ... had an average age of 57.4 (41-89) which is consistent with the age-related decline of 1% to 2% cited above for women of menopausal age as well as with the data reported in the meta-analysis As...
- 12
- 663
- 0
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
... cortex and pyramidal tract to the ventral brain stem The involuntary path is comprised of amygdala, thalamic, hypothalamic, and subthalamic areas, in addition to the dorsal brain stem Moreover, the ... pathways, the “voluntary path” and the “involuntary path” otherwise known as the “emotionally-driven path” (5) The voluntary pathway begins from the premotor opercular areas and travels via the ... Statistical analysis The data was analyzed using both parametric and non parametric statistics and the specific test used was indicated with the respective results If assumptions of normality and...
- 12
- 757
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig 1A) The ... 14 Ogawa Y, Itoh H, Nakagawa O, et al Characterization of the 5'-flanking region and chromosomal assignment of the human brain natriuretic peptide gene J Mol Med 1995; 73: 457-63 15 Nakayama T, ... nucleotides and alters the binding sites for the AP2 and zeste transcription factors Transcriptional activity of the deletion allele was less than 30% that of the wild-type allele The deletion allele was...
- 7
- 612
- 1
A critical discourse analysis of the news on north korean missile launches part 3
... LIST OF TABLES Table Names for US-Japan coalition and North Korea in VOA Table Names for US-Japan coalition and North Korea in Nhan Dan Table Negativization of North Korea’s activities in VOA Table ... Positivization of the US- Japan coalition’s activities in VOA Table Lexicalization of North Korea’s activities in Nhan Dan Table Lexicalization of the US-Japan coalition’s activities in Nhan Dan Table ... Over-lexicalization of the North Korea’s missile launches in VOA Table Over-lexicalization of the North Korea’s missile launches in Nhan Dan Table Quotation patterns of news reports in VOA Table 10...
- 4
- 828
- 6
A critical discourse analysis of the news on north korean missile launches part 4
... from the Voice of America and Nhan Dan These two sources are chosen as the database for the analysis as they are both popular and reliable sources of information 2.1.1.1 Voice Of America The Voice ... the rationale, the scope of the research, the aims of the research, the methodology and the design of the research - Part 2- Development: This is the main part of the thesis and has three chapters ... disclosing the discursive nature of much contemporary social and cultural change Particularly the language of the mass media is scrutinized as a site of power, of struggle and also as a site where language...
- 20
- 811
- 0
A critical discourse analysis of the news on north korean missile launches part 5
... processes are attributed to the US and Japan (76.9%) and all these processes are either verbal (60%) or material (40%) The US and Japan play the role of actor and sayer in all the processes In material ... neutral and formal names to refer to both North Korea and the US- Japan coalition, Nhan Dan treated them equally and viewed them as having equal right and power The analysis of lexicalization further ... explicitly associates the US and Japan with positive values and goals 3.2.2.2 Nhan Dan The analysis of lexicalization shows that in Nhan Dan the wordings for North Korea’s and the US- Japan coalition’s...
- 28
- 603
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25