a teleradiology platform emphasizing security of data and communication

Báo cáo y học: "The emerging modern face of mood disorders: a didactic editorial with a detailed presentation of data and definitions" potx

Báo cáo y học: "The emerging modern face of mood disorders: a didactic editorial with a detailed presentation of data and definitions" potx

Ngày tải lên : 08/08/2014, 23:21
... clinician to obtain a variety of laboratory examination data, including standard blood and biochemical tests, EEGs, electrocardiograms (ECGs), thyroid function tests and (depending on availability and ... influenza, viral pneumonia, viral hepatitis, infectious mononucleosis and AIDS, and nutritional conditions such as pellagra and pernicious anaemia A number of pharmacological agents used for the treatment ... refractory to explanations, confrontation and to a significant extent they lack self-examination and insight; because of this lack of insight, mania nearly always, sooner or later, acquires a delusional...
  • 22
  • 421
  • 0
The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

The Duality of Memory and Communication in the Implementation of a Multiprocessor Operating System

Ngày tải lên : 12/09/2012, 15:05
... similar in nature to a data manager which fails to free data, but is easier to detect and prevent • Data manager changes data A malicious data manager may change the value of its data on each cache ... access to cached data than the data manager has permitted (e.g., a write fault on a page made read-only by a pager _data_ lock call), the kernel issues a pager _data_ unlock call The data manager is ... Requests data from an external data manager pager _data_ write(memory_object, offset, data, data_ count) Writes data back to a memory object pager _data_ unlock(memory_object, pager_request_port, offset,...
  • 23
  • 1.3K
  • 1
TEACHING PRONUNCIATION TO THE FIRST YEAR STUDENTS AT THE UNIVERSITY OF TRANSPORT AND COMMUNICATIONS a CASE STUDY

TEACHING PRONUNCIATION TO THE FIRST YEAR STUDENTS AT THE UNIVERSITY OF TRANSPORT AND COMMUNICATIONS a CASE STUDY

Ngày tải lên : 07/09/2013, 13:45
... Pronunciation is not an optional extra for the language learner, any more than grammar, vocabulary or any other aspect of language (Tench, 1981) ‘Pronunciation’ is defined as A way of speaking a word, ... beliefs and knowledge in pronunciation teaching; - Formal curricula; - Teaching goal and assessment; - Approaches and techniques; - Teacher’s roles - Teaching and learning materials The data were ... (Hang, aged 40) The teachers developed a wealth of resources for other teaching areas such as grammar and vocabulary They felt that an equally diverse range of materials for pronunciation was...
  • 40
  • 984
  • 4
Conventional Providing a Uniform Law for Bill of exchange and Promissory Notes

Conventional Providing a Uniform Law for Bill of exchange and Promissory Notes

Ngày tải lên : 22/10/2013, 10:15
... the case of a bill payable at the address of a 74 third party or in a locality other than that of the domicile of the drawee, or, except in the case of a bill drawn payable at a fixed period after ... has a direct action on the bill of exchange against the acceptor for all that can be demanded in accordance with Articles 48 and 49 Article 29 Where the drawee who has put his acceptance on a ... bill of exchange against the 273 274 acceptor are barred after three years, reckoned from the date of maturity Actions by the holder against the endorsers and against 275 the drawer are barred after...
  • 37
  • 673
  • 0
A study on the aspects of syntax and semantics of negation in english and the contrastive analysis in vietnamese

A study on the aspects of syntax and semantics of negation in english and the contrastive analysis in vietnamese

Ngày tải lên : 11/12/2013, 23:53
... word meaning Word meaning consists of grammatical meaning and lexical meaning Grammatical meaning unites all grammatical characteristics of a word and lexical meaning is a realization of a concept ... text of President Barack Obamas inaugural address After having a careful analysis on syntactic and semantic features of negation in English and its equivalents in Vietnamese, this graduation paper ... study and a central concern of applied linguistics As a matter of fact, CA has had much to offer not only to practical language but also to translation theory, the description of particular language,...
  • 51
  • 1.1K
  • 8
A study on english reading strategies employed by second year bridge and road students university of transport and communications

A study on english reading strategies employed by second year bridge and road students university of transport and communications

Ngày tải lên : 29/01/2014, 10:33
... broad categories of learning strategies and a number of secondary categories The primary classification includes an active task approach, realization of language as a means of communication and ... question as I know that South Africa, Malaysia and all of Canada not speak English as the native language… Inferencing Using available information to guess I guess that Artificial language is not meanings ... both a quantitative and qualitative analysis of data For the questionnaire data and think-aloud report data, significant differences in mean responses between the effective and ineffective reader...
  • 79
  • 668
  • 0
Tài liệu A FORAY INTO THE WORLDS OF ANIMALS AND HUMANS doc

Tài liệu A FORAY INTO THE WORLDS OF ANIMALS AND HUMANS doc

Ngày tải lên : 12/02/2014, 16:20
... and Movement as Perception Marks 86 Goal and Plan 92 Perception Image and Effect Image 98 The Familiar Path 103 Home and Territory 108 The Companion H3 Search Image and Search Tone 119 Magical ... learn grammar, and a cultural ability to play in a semiotic space t h a t can virally spread new and discard old words as well as other abstract signs, depends on the ability to realign neuronal ... is an android whose fabricators at the Rosen Association have implanted artificial memories in her that make her initially think she's human Real animals are a symbol of status, ecologically rare,...
  • 281
  • 957
  • 1
IN A PERFECT OCEAN THE STATE OF FISHERIES AND ECOSYSTEMS IN THE NORTH ATLANTIC OCEAN pdf

IN A PERFECT OCEAN THE STATE OF FISHERIES AND ECOSYSTEMS IN THE NORTH ATLANTIC OCEAN pdf

Ngày tải lên : 06/03/2014, 18:21
... the appearance of humans Thus disappeared the giant kangaroos and wombats of Australia 50,000 years ago, and the elephant-like mastodons and the sloth of North America about 13,000 years ago The ... Central Atlantic), and part of Area 18 (Arctic Sea) Overall, these areas are too large to allow for ecological considerations (see top map) Large Marine Ecosystems (LME) are smaller, and allow ... deliberate hunting of whales—as opposed to the occasional consumption of stranded individuals—was probably initiated in Scandinavia a thousand years ago, and then further developed by the Basques,...
  • 206
  • 576
  • 0
A study on the sounds of vowels and consonants in English

A study on the sounds of vowels and consonants in English

Ngày tải lên : 20/03/2014, 01:26
... the vocal tract These different parts are called “articulators” Diagram of articulators above the larynx The articulators that can‟t move are called “the passive articulator” (teeth, alveolar ridge…) ... front of the tongue and the hard palate Palatal – alveolar/ ʃ, ʒ, tʃ, dʒ / are the sounds made with the palate of the tongue and the back of the alveolar ridge 17 Velars/k, g, ŋ/ are the sounds made ... dʒ/ Lareral sound: /l/ 16 bilabial labiodental dental alveolar plosive nasal approximant r retroflex palatal velar glottal d t m f v θ ð s kɡ n p b fricative postalveola ŋ z ʃ ʒ (w) h r lateral...
  • 67
  • 1.3K
  • 5
death of a generation how the assassinations of diem and jfk prolonged the vietnam war

death of a generation how the assassinations of diem and jfk prolonged the vietnam war

Ngày tải lên : 01/06/2014, 00:39
... of programs available for Linux, its uses can range from a single task as a monitor, to uses as a workstation for calculating advanced mathematical formulas or graphics You can use Linux as an ... no chance to make it because of no available source code Linux encourages individual adjustments, modifications, and fixes because the source is always available As a result of the available ... use of the tools available, just as a stack of boards, nails, and a hammer don’t make a house — it takes the skilled craftsmanship of a carpenter to turn the parts into a whole house Debian GNU/Linux...
  • 677
  • 552
  • 0
Báo cáo hóa học: " Research Article A Simulation Study: The Impact of Random and Realistic Mobility Models on the Performance of Bypass-AODV in Ad Hoc Wireless Networks" pdf

Báo cáo hóa học: " Research Article A Simulation Study: The Impact of Random and Realistic Mobility Models on the Performance of Bypass-AODV in Ad Hoc Wireless Networks" pdf

Ngày tải lên : 21/06/2014, 11:20
... protocol against large data packets and excessive overhead The IEEE 802.11 MAC standard [15] and the TCP NewReno are used at the MAC and TCP layers, respectively The transmission rate is assumed ... constant at Mbps In each simulation-iteration, we generate a scenario with a source-destination pair that is randomly and uniformly Maximum speed (Vmax ) Packet size Pause time (Tpause ) SDR and ADR ... successor via an alternative node By restricting the bypass to a very small topological radius, route adaptations occur only locally and communication costs are small This approach has two main properties:...
  • 10
  • 604
  • 0
Báo cáo khoa học: " Intensity-modulated radiotherapy of nasopharyngeal carcinoma: a comparative treatment planning study of photons and protons" pps

Báo cáo khoa học: " Intensity-modulated radiotherapy of nasopharyngeal carcinoma: a comparative treatment planning study of photons and protons" pps

Ngày tải lên : 09/08/2014, 09:22
... 10-year actuarial rate of severe complications was reported to be as high as 24% and two cases of second malignancies in salivary glands were observed after median latency of eight years [38] Among ... plans Exceptions were the values for Dmax of the brainstem, TM joints, oral cavity, pituitary gland, and the skin and for Dmean of the pituitary gland For locally advanced tumors, IMPT plans had ... levels of the clinoids, skin, TM joints, pituitary and thyroid glands, larynx/esophagus, and the oral cavity were also delineated All target volumes and OARs were delineated by the same radiation...
  • 15
  • 389
  • 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

Ngày tải lên : 11/08/2014, 08:20
... chosen that span introns of CD4 and CD8 genes in order to avoid amplification of cellular DNA contaminating RNA preparations Products are generated from cDNA and deletional mutants are constructed ... Lipman et al., (1994), and were kindly provided by Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' ... extraction and reverse transcription is determined by quantification of GAPDH mRNA by QC-RT-PCR Each value for quantity of CD4 or CD8 mRNA was standardized according to the amount of GAPDH mRNA...
  • 4
  • 319
  • 0
Báo cáo y học: " Involving relatives in relapse prevention for bipolar disorder: a multi-perspective qualitative study of value and barriers" pptx

Báo cáo y học: " Involving relatives in relapse prevention for bipolar disorder: a multi-perspective qualitative study of value and barriers" pptx

Ngày tải lên : 11/08/2014, 16:20
... [29] A qualitative approach was employed which provided rich data grounded in stakeholders views and ideas [30] With 52 participants, the sample was large and thematic saturation was assured A particular ... refined and elaborated in light of incoming data and analysis employing an inductive stance The interviewer conducted the analysis on all interviews In addition, each interview was separately analyzed ... saturation was achieved In reporting the final analysis the data are presented to illustrate the range and commonality of meaning of each category Results The analysis focuses on participants’...
  • 29
  • 347
  • 0
báo cáo khoa học: " Surface electromyography as a screening method for evaluation of dysphagia and odynophagia" ppt

báo cáo khoa học: " Surface electromyography as a screening method for evaluation of dysphagia and odynophagia" ppt

Ngày tải lên : 11/08/2014, 20:20
... aetiology and localization – oral, pharyngeal, or oesophageal – of causes for dysphagia or odynophagia Each stage has its mean normal duration and its specific graphic pattern Each pair of electrodes ... timely addition to our evaluation techniques 16 Summary 17 Surface SEMG of swallowing is a simple and reliable method for screening and initial evaluation of dysphagia and odynophagia complaints of ... providing both qualitative and quantitative data • simple and easy to operate In general, aim of a screening procedure is to separate patients into a "passed"- vs "failed" group, specifically into groups...
  • 11
  • 315
  • 0
A survey on the attitude of teachers and students toward the integration of some cultural elements in the textbook New English file - elementary in speaking les

A survey on the attitude of teachers and students toward the integration of some cultural elements in the textbook New English file - elementary in speaking les

Ngày tải lên : 28/03/2015, 08:55
... learning language.” (Eli Hinkel, 1999) In fact, language is part of a culture; language is deeply embedded in a culture; language and culture cannot be separated, and we cannot teach a language without ... understand the history of Anglo-American state or nation, geography, traditions and customs, lifestyle, literature and art, code of conduct, ways of thinking and values to expand the horizons of ... real situations Facts have shown that culture and language are two sides of a piece of paper Language expresses, embodies, and symbolizes cultural reality and in return cultural knowledge makes...
  • 59
  • 670
  • 2
A study on the reality of teaching and learning English pronunciation skills to the 11th graders at Kien An high school =Nghiên cứu thực trạng dạy và học kỹ năn

A study on the reality of teaching and learning English pronunciation skills to the 11th graders at Kien An high school =Nghiên cứu thực trạng dạy và học kỹ năn

Ngày tải lên : 28/03/2015, 09:33
... pronunciation in all observed classes They explained that there are many things to teach and train in one period, especially in vocabulary and grammar part, because vocabulary and grammar are useful ... pronunciation features, especially stress and intonation, and master them is one of the ways to help language teachers and learners succeed in teaching and learning pronunciation in particular and speaking ... conditions as well as increasing time for teaching and learning pronunciation in class In summary, the data analysis above reveals the truth that the majority of teachers and students at Kien An high...
  • 60
  • 1.3K
  • 5
Application of data and information fusion

Application of data and information fusion

Ngày tải lên : 11/09/2015, 09:10
... planning and data analysis phases of PE based on formalized methods and associated analysis techniques They also carried out various analyses and an additional case study associated with their ... posed by a given intruder aircraft on a specified asset, the proposed approach made use of target state estimates and their measures of uncertainty from a tracking and data fusion module An and Liu ... Refinement) an element of Knowledge Management that encompasses adaptivity in the determination of user query and access to information, as well as adaptivity in the retrieval and display of data, to...
  • 226
  • 249
  • 0
A new hybrid treatment system of bioreactors and electrocoagulation for superior removal of organic and nutrient pollutants from municipal wastewater

A new hybrid treatment system of bioreactors and electrocoagulation for superior removal of organic and nutrient pollutants from municipal wastewater

Ngày tải lên : 13/09/2015, 17:48
... being available in the inflow of wastewater, alkalinity is also Table Summary of some key operating parameters and results during operation of EC process No Parameters Average (range) Initial T-P ... M., Ohashi, A. , Harada, H., 2007 Performance comparison of a pilot-scale UASB and DHS system and activated sludge process for the treatment of municipal wastewater Water Res 41, 2697–2705 Wahab, ... enrichment of surface waters, a number of wastewater treatment plants have adopted various treatment systems that can highly and simultaneously remove nitrogen and phosphorus from wastewater Among...
  • 11
  • 565
  • 0

Xem thêm