a technique to mitigate the effects of fading and dispersion

A computational study to investigate the effects of insulation and EGR in a diesel engine

Ngày tải lên : 05/09/2013, 16:11

... temperature regions for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local ... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... cylinder wall and the cylinder wall opposite to the pre-chamber at approximately the same time It reveals that the flame started in pre-chamber and then invades a large portion of the main-chamber...

20
643
0

báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx

Ngày tải lên : 09/08/2014, 01:24

... spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate analysis However, there was no significant association ... node spread and vascular invasion were still significant in a stepwise multivariate analysis for all invasive carcinomas and the subgroup of IDC (Table 2) Further univariate analyses revealed no ... breast ductal carcinoma: pathologic correlations and prognostic implications Hum Pathol 2001, 32(1):89-94 Sasano H, Frost AR, Saitoh R, Taniyama Y, Nagura H, Matsunaga G, Takehana K, Kimura M,...

9
423
0

The Weapons Mix Problem - A Math Model to Quantify the Effects of Internetting of Fires to the Future Force pptx

Ngày tải lên : 23/03/2014, 02:20

... brought into a variety of programs for analysis The details and full description of the mathematical model at the heart of the IOF Allocator and its implementation are included in Appendixes A and ... The IOF Allocator as Part of a Suite of Analytical Tools xii Internetting of Fires Is the Dynamic Pooling of Resources Enabled by C4ISR The IOF Allocator as Part of the WMT Suite of Analytical ... preventing the shooters from attacking dead targets (which also may lead to an overestimation of the damage to targeted systems) This too was not a limitation to the IOF Allocator but rather of the...

48
369
0

Báo cáo y học: "Response of the mouse lung transcriptome to welding fume: effects of stainless and mild steel fumes on lung gene expression in A/J and C57BL/6J mice" pot

Ngày tải lên : 12/08/2014, 11:22

... the animal exposures, isolated the RNA, ran the arrays and the IPA analysis and drafted the manuscript MLK and SL were responsible for the statistical design, data management, statistical analysis ... beadchip contains > 24,000 well annotated RefSeq transcripts and allows samples to be interrogated in parallel To minimize array to array variability, a cRNA sample from each of the sham, GMA-MS ... Functional analysis of the lung response after GMA-MS and GMA-SS exposure Reported in tables 1, 2, and are the associated categories of diseases and disorders, molecular and cellular functions and...

18
382
0

AN1050 a technique to increase the frequency resolution of PICmicro® MCU PWM modules

Ngày tải lên : 11/01/2016, 16:37

... is toggled each time the period of the output signal is changed as a timing reference The graph in Figure has been recorded using the MPLAB SIM simulator and taking a snapshot of the Logic Analyzer ... generate a variable frequency digital signal with good frequency resolution using a combination of on-chip hardware and software The provided code example generates a 100 kHz signal that can be adjusted ... restrictions may subject the user to criminal sanctions under applicable laws, as well as to civil liability for the breach of the terms and conditions of this license THIS SOFTWARE IS PROVIDED IN AN “AS...

10
194
0

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

Ngày tải lên : 24/09/2012, 17:19

... propriety assets According to him, Brand loyalty has to with the level of devotion a consumer has to a brand Brand awareness has to with the ability of a potential buyer to identify a brand among a product ... brand awareness: • Involve a slogan or jingle: a slogan is a visible feature of a brand There can be a strong link between a slogan and a brand The slogan and jingle are powerful and can be a ... enables them to differentiate a brand from another 2.3.4 Brand loyalty According to Aaker (1991, p39), brand loyalty is the attachment that a customer has to a brand” Yoo and Donthun (2001) also...

88
986
8

Music cover, the effects of it and The attitudes of NEU’s students to Music cover in Vietnam

Ngày tải lên : 21/04/2013, 20:53

... students are the perfect entity to take the research The study illustrates the effects of music cover and NEU students’ behaviors towards the spread of the music cover trend at the moment In the paper, ... lyrics of the original song and they make comparison, they mainly recognize that major of covered songs are not as good as the original ones Hence, they may look down on the musicians, singers and ... this part, the matter in the study will be summarized again Besides, perhaps there are limitations or some recommendation for further study At the end of the paper there are two extra parts: appendices...

23
567
0

An investigation into the effects of brainstorming and giving a text as model on phan dinh phung high school student's attitude and writing ability

Ngày tải lên : 18/12/2013, 10:08

... students began to be regarded as thinker or creators of language, instead of the traditional views as empty to be regarded ad thinkers or creators of language, instead of the traditional view as empty ... stating the topic: Teacher states the topic and write it on the black board and then give some explanations that may be needed that may be needed The topic to brainstorm can also come from a ... in the group to gain a better understanding of the topic and had added benefit of creating a feeling of common ownership of results Table 8: The reasons for the approval of the application of...

60
717
0

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Ngày tải lên : 19/02/2014, 17:20

... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...

12
616
0

Báo cáo khoa học: The oxidative effect of bacterial lipopolysaccharide on native and cross-linked human hemoglobin as a function of the structure of the lipopolysaccharide A comparison of the effects of smooth and rough lipopolysaccharide ppt

Ngày tải lên : 08/03/2014, 10:20

... oxidation was due to the a chains and the slow phase was due to the b chains Tsuruga et al found that the beta chain of the tetramer does not exhibit any proton-catalyzed auto-oxidation [22] These authors ... Winterhalter [5] reported that the oxidation of the a chains of Hb A0 was 10 times faster than that of the beta chains and that the oxidation of the beta chains was not inﬂuenced by pH The biphasic ... LPSs, the effect of EDTA was to reduce the oxidation rate A comparison with the auto-oxidation rate (data from Fig 3) revealed that in the presence of EDTA, the increase in the rate of oxidation of...

6
748
0

báo cáo hóa học:" A lifeline to treatment: the role of Indian generic manufacturers in supplying antiretroviral medicines to developing countries" pptx

Ngày tải lên : 20/06/2014, 08:20

... performed data cleaning and data analysis SM contributed to data analysis, writing of the manuscript, and editing for important content All authors read and approved the final version of the manuscript ... School of Government, Cambridge, MA, USA Page of Authors’ contributions BW designed and coordinated the study, participated in data cleaning and data analysis, and was the lead author on this paper ... acceptable dosage forms, and delay access to newer and better ARVs Such measures can undermine the international goal to achieve universal access to HIV/AIDS interventions and the 2001 WTO Doha Declaration...

9
283
0

báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot

Ngày tải lên : 20/06/2014, 15:20

... discriminate amongst those who rate the care as excellent Rasch analysis in particular can aid the selection of these additional items Rasch analysis can also further assess the unidimensionality of the ... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar ... (Table 2), and their transcripts content analysed This generated conceptual ideas about the main areas of relapse management, with around 1000 statements on people’s Riazi et al Health and Quality...

8
492
0

Báo cáo hóa học: " Differential Gene Expression to Investigate the Effects of Low-level Electrochemical Currents on Bacillus subtilis" doc

Ngày tải lên : 20/06/2014, 23:20

... The isolated RNA was stored at -80°C until DNA microarray analysis DNA Microarray Analysis The total RNA samples were sent to the DNA Microarray Core Facilities at SUNY Upstate Medical University ... resistance genes were induced or up-regulated such as arsBCR, appBCF and zosA at 83 A/ cm2, and copAB at 250 A/ cm2 The arsBCR operon is responsible for the transport of arsenate, arsenite, and antimonite ... 168, Dr Vasantha Nagarajan at DuPont Central Research and Development for sharing the strain B subtilis BE1500, and Prof Yan-Yeung Luk at Syracuse University for the access to a potentiostat 22...

47
419
1

báo cáo khoa học: "Feedback GAP: study protocol for a clusterrandomized trial of goal setting and action plans to increase the effectiveness of audit and feedback interventions in primary care" pdf

Ngày tải lên : 10/08/2014, 10:23

... explore the barriers and facilitators to Ontario family physicians’ acceptance and utilization of performance feedback, and to examine the perceived actionability of various approaches to the design ... human behavior Edited by: Ramachandran VS Toronto: Academic Press; 1994:71-81 Ajzen I, Manstead ASR: Changing health-related behaviors: An approach based on the theory of planned behavior In The ... amongst Canadian family practitioners, who manage the bulk of care for these patients [2] Unfortunately, there remains a large gap between ideal and actual care provided to such patients, making them...

10
597
0

Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc

Ngày tải lên : 11/08/2014, 05:21

... Damanpour F: Organizational innovation: a meta-analysis of effects of determinants and moderators Academy of Management Journal 1991, 34:555-590 Damanpour F: Organizational complexity and innovation: ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and ... development of the manuscript NE participated in the design and analysis of the study, and contributed to the manuscript NH participated in data collection, and helped to draft the manuscript MJ assisted...

9
506
0

báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf

Ngày tải lên : 11/08/2014, 16:20

... Damanpour F: Organizational innovation: a meta-analysis of effects of determinants and moderators Academy of Management Journal 1991, 34:555-590 Damanpour F: Organizational complexity and innovation: ... questions), there were some highly skilled people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and ... development of the manuscript NE participated in the design and analysis of the study, and contributed to the manuscript NH participated in data collection, and helped to draft the manuscript MJ assisted...

9
412
0

Báo cáo y học: "Using single nucleotide polymorphisms as a means to understanding the pathophysiology of asthma" pps

Ngày tải lên : 12/08/2014, 18:20

... emphasis away from linkage analysis and microsatellite markers towards SNP genotyping and different analytical strategies based on association and haplotype analysis [31–34] Association analyses are ... growing list of candidate genes investigated with regard to traits associated with asthma and atopy The most investigated candidate location for atopy and asthma susceptibility loci has been the 5q31–33 ... Sasaki S, Adra CN, Kitaichi M, Inoue H, Yamauchi K, Tomichi N, Kurimoto F, Hamasaki N, Hopkin JM, Izuhara K, Shirakawa T, Deichmann KA: Genetic variants of IL-13 signalling and human asthma and...

11
491
0

Báo cáo y học: " A method to estimate the efficiency of gene expression from an integrated retroviral vector" potx

Ngày tải lên : 13/08/2014, 09:20

... to detect the ampicillin resistant gene are AmpF (5'-gataacactgcggccaactt-3') and AmpR (5'-ttgccgggaagctagagtaa-3') The reactions were cycled either in a Perkin Elmer thermocycler (DNA Thermal ... was estimated by the cell count, C of the sample The proportion P0 was calculated on each day where usable data of the sample culture were available and then averaged Competing interests The author(s) ... count at day 21 was expressed as a proportion of the peak count reached by the culture (CT) The data was plotted onto a graph (Figure 4) The data in this table are not directly comparable to that...

10
278
0

Báo cáo y học: " Inflammation: a way to understanding the evolution of portal hypertension" ppsx

Ngày tải lên : 13/08/2014, 16:21

... Histamine and serotonin stand out among mediators released by mast cells and cause vasodilation and edema due to increased vascular permeability [71] Neutral proteases may also regulate the tone ... SWM, Jalan R: Role of ammonia and inflammation in minimal hepatic encephalopathy Metab Brain Dis 2007, 22:125-138 Arias JL, Aller MA, Sanchez-Patan F, Arias J: The inflammatory bases of hepatic ... endothelial cells and form the distal part of the yolk sac These endothelial cells of the blood islands expand to cover the entire yolk sac forming a vascular network, known as the capillary...

25
313
0