0

a technique for practising conditional sentences

A Technique for Practising Conditional Sentences

A Technique for Practising Conditional Sentences

Tư liệu khác

... stories All types of conditionals can be practiced at the same time It is essential, however, that learners know the difference in meaning and usage of various types of conditionals Short Narrations ... wouldn't have had so much to drink If I hadn't had so much to drink, I wouldn't have started a fight If I hadn't started a fight, I wouldn't have been taken to the police station If I hadn't been arrested ... is another variation of the whole class activity Divide the class into two equal groups Ask the first group to write only 'if clauses', and the second group only 'major clauses' Allocate a student-assessor...
  • 2
  • 452
  • 1
A Technique for Practising Conditional Sentence1

A Technique for Practising Conditional Sentence1

Tư liệu khác

... stories All types of conditionals can be practiced at the same time It is essential, however, that learners know the difference in meaning and usage of various types of conditionals Short Narrations ... wouldn't have had so much to drink If I hadn't had so much to drink, I wouldn't have started a fight If I hadn't started a fight, I wouldn't have been taken to the police station If I hadn't been arrested ... is another variation of the whole class activity Divide the class into two equal groups Ask the first group to write only 'if clauses', and the second group only 'major clauses' Allocate a student-assessor...
  • 2
  • 283
  • 0
A STUDY ON UNREAL CONDITIONAL SENTENCES AND WAYS TO TRASLATE THEM INTO VIETNAMESE

A STUDY ON UNREAL CONDITIONAL SENTENCES AND WAYS TO TRASLATE THEM INTO VIETNAMESE

Khoa học xã hội

... textbook for translation” Newmark provided a V diagram SL emphasis Word -for- word translation Literal translation Faithful translation Semantic translation TL emphasis Adaptation free translation ... the form of the original Usually it is a paraphrase much longer than the original, a so-called “intralingua translation”, often prolix and pretentious, and not translation at all Idiomatic translation ... semantic content while a semantic translation is always inferior to its original A semantic translation has to interpret; a communicative translation has to explain Communicative translation allows...
  • 65
  • 693
  • 1
Báo cáo hóa học:

Báo cáo hóa học: " A Technique for Dominant Path Delay Estimation in an OFDM System and Its Application to Frame " docx

Báo cáo khoa học

... of a window of 2M samples R(d) gives an estimate of the energy in M samples of the received signal For a specified SNR, mean and variance of M(d) are analytically evaluated for AWGN channel, and ... the signal arriving through a delayed path may be larger than that of the earliest path In those cases, the estimate of the frame boundary may be shifted by a quantity equal to the delay of the ... was on the Faculty of IIT, Madras, IIT, Kharagpur, Osmania University and Indian Institute of Science (IISc), Bangalore At Osmania University, he established the Research and Training Unit for...
  • 8
  • 420
  • 0
Báo cáo y học:

Báo cáo y học: "Dermoscopy as a technique for the early identification of foot melanoma" pot

Báo cáo khoa học

... 134:563-568 Saida T, Miyazaki A, Oguchi S, Ishihara Y, Yamazaki Y, Murase S, Yoshikawa S, Tsuchida T, Kawabata Y, Tamaki K: Significance of dermoscopic patterns in detecting malignant melanoma on acral ... Yoshida N, Ikegawa S, Ishihara K, Nakajima T: Clinical guidelines for the early detection of plantar malignant melanoma J Am Acad Dermatol 1990, 23:37-40 Miyazaki A, Saida T, Koga H, Oguchi S, ... Extent and consequences of physician delay in the diagnosis of acral melanoma Melanoma Res 1998, 8:181-186 Dalmau J, Abellaneda C, Puig S, Zaballos P, Malvehy J: Acral Melanoma Simulating Warts:...
  • 6
  • 413
  • 0
A study of english vietnamese translation of conditional sentences

A study of english vietnamese translation of conditional sentences

Khoa học xã hội

... Vietnamese – English materials B.Hatim and I.Mason (1989) analyzed the relation between translation and other factors that are related to translating process such as context, structures and pragmatics ... in conditional sentences 3.2 RESEARCH PROCEDURE are always true and always happen under certain conditions They are 3.3 DATA COLLECTION AND ANALYSIS scientific facts and general truths The translation ... chó n a. ) sentences - Links in conditional clauses can be translated as + The conditional sentences in (90) – (94) are translated as “n u, n u như, gi s ”, and verb phrases in threat and we can...
  • 13
  • 2,127
  • 6
A study on conditional sentences in english and vietnamese

A study on conditional sentences in english and vietnamese

Khoa học xã hội

... Le has a different approach to analyzing conditional sentences He analyzed each pair of conditional links in great detail, which can help the reader to understand Vietnamese conditional sentences ... (predictive) conditional relationships, hypothetical conditional relationships 22 2.2.1 Factual Conditional Sentences: Factual conditional sentences often appear in everyday English language and ESL/ ... sentences They are often anaphoric, referring back to an earlier unit As Halliday and Hasan (1976) have point out, there are certain proforms that can be used to replace the entire conditional...
  • 71
  • 1,643
  • 16
A STUDY ON GROUPWORKS  a TECHNIQUE USED IN TEACHING SPEAKING SKILL FOR THE 2ND –YEAR ENGLISH MAJOR STUDENTS AT HPU

A STUDY ON GROUPWORKS a TECHNIQUE USED IN TEACHING SPEAKING SKILL FOR THE 2ND –YEAR ENGLISH MAJOR STUDENTS AT HPU

Khoa học xã hội

... a teacher to collect a large amount of information relatively quickly” Another advantage of this tool is that the collected data are relatively easy to summarize and report as all the informants ... information for their speaking activities It may be a paragraph, a magazine, a report, and a book…this show that, reading supports speaking by providing necessary information Students must have ... students equate being able to speak a language as knowing the language and therefore view learning the language as learning how to speak the language , or as Nunan (1991) wrote, “success is measured...
  • 97
  • 1,237
  • 4
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A PROGRAM FOR ALIGNING SENTENCES IN BILINGUAL CORPORA" docx

Báo cáo khoa học

... concordance (Table 4) for use in lexicography (Klavans and Tzoukermann, 1990) 178 It is remarkable that such a simple approach can work as well as it does An evaluation was performed based on a trilingual ... with a standardized (mean zero, variance one) normal distribution, has magnitude at least as large as 18 [ This distance measure is based on the assumption that each character in one language, L ... defined to "match" if they shared a common clause (In a few cases, a pair of sentences shared only a phrase or a word, rather than a clause; these sentences did not count as a "match" for the purposes...
  • 8
  • 494
  • 0
Novel technique for rapid detection of a-globin gene mutations and deletions pot

Novel technique for rapid detection of a-globin gene mutations and deletions pot

Báo cáo khoa học

... — peak peaks peak — aa/aa CS/aa QS/aa WS/aa of mutation carrier samples, as follows: cases of aCSa/ aa, cases of aQSa/aa, and cases of aWSa/aa (Table I) These results were in accordance with ... /QS cases, and /WS cases) 2a3 .7/aa 2a4 .2/aa 2a3 .7/ -a4 .2 2a3 .7/- 2a4 .2/- 2a3 .7/ -a3 .7 2a4 .2/ -a4 .2 /-aa/aa (including CS/aa cases, QS/aa cases, and WS/aa cases) the original genotype The method has ... for the duplex PCR products of DNA samples of known genotypes at 50 C SEA/ SEA; SEA/aa; -SEA/aCSa; aa/aa; 5 23.7/aa; 24.2/aa; aQSaa/ aa The peak appeared at 5.1 0.1 min, which indicates aa,...
  • 8
  • 557
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Figure of Merit Technique for the Resolution of Non-Grammatical Ambiguity" ppt

Báo cáo khoa học

... Collection and Organization of Data on Word Occurrences In order to assign relative probability measures to a fairly large number of target equivalents, a statistical analysis was performed manually ... depends upon the availability of the probability measures of target equivalents, only those target equivalents for which such information is available from the data are used in the calculations described ... collecting the data from a much larger sample than the one that was used in the above calculations Such a RESOLUTION OF NON-GRAMMATICAL AMBIGUITY collection of data could be done by means of a computer...
  • 5
  • 298
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot

Hóa học - Dầu khí

... 18 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... extension to n-ary classification systems (e.g dim, intermediate, bright) is possible After derivation of frequencies for all sets, data was loaded into a relational database (MySQL) and analyzed with ... The Average CV (CV computed for each patient, then all patients averaged) is shown for each phenotype All Average CV values are less than 16%, suggesting stable expression over time for each...
  • 15
  • 476
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Điện - Điện tử

... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGCCTGTACCCAAGCATTATTCAGGCACACAATCTGTGT GTAGTTGACTTTGCCAGCTTGTACCCCAGCATCATCCAGGCTCATAATCTATGC ... (151aa) CAB61754 (151aa) AAC55648 (55aa) AAD30141 (56aa) AAG23218 (158aa) AAC57974 (151aa) DFASA-GDTD1B AAF23082 (158aa) DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B DFASA-GDTD1B ... GTTTTTGATTTCCAAAGTTTGTATCCAAGTATTATGATGGCTCATAATCTGTGT RhCMV GTGTTTGACTTTGCCAGCCTGTATCCGTCAATTATCATGGCACATAATCTCTGT RFHVMm GTTGTGGATTTTGCTAGCCTTTATCCCAGCATCATGCAGGCCCACAACCTATGT γ AtHV3 GTAGTAGACTTTGCTAGCCTTTACCCAAGTATTATACAAGCTCATAATCTGTGT...
  • 24
  • 604
  • 0
báo cáo hóa học:

báo cáo hóa học:" In vivo evaluation of a vibration analysis technique for the per-operative monitoring of the fixation of hip prostheses" pdf

Hóa học - Dầu khí

... for the mechanical characterization of the primary bone-prosthesis stability In a previous study we demonstrated the feasibility and validity of a vibration analysis technique for the assessment ... stages and canal and reinserting the prosthesis The FRF had a normal evolution during the reinsertion and the graphs corresponding to the final two stages, labelled as stage 4a and stage 5a, are ... been avoided in the case of an abnormal bone structure and a deformed endomedullary canal as the FRF analysis showed an abnormality and the surgeon was alerted to the situation in time during insertion...
  • 10
  • 542
  • 0
báo cáo hóa học:

báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx

Hóa học - Dầu khí

... limitations has led to a situation where damage is continuing and has placed many important items at risk This has created an urgent need for a technique that can capture the information in each ... 125–135, 1997 E Prados, F Camilli, and O Faugeras, A unifying and rigorous shape from shading method adapted to realistic data and applications,” Journal of Mathematical Imaging and Vision, vol ... intensity values are normalized to one, and the scale factor, the Gaussian amplitude α, is saved as the attenuation factor for that pixel Then a nonlinear Gaussian fit is performed on the normalized...
  • 13
  • 569
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A Suboptimal PTS Algorithm Based on Particle Swarm Optimization Technique for PAPR Reduction in OFDM Systems" potx

Hóa học - Dầu khí

... an OFDM signal by use of PTS with low computational complexity,” IEEE Transactions on Broadcasting, vol 52, no 1, pp 83–86, 2006 [14] A D S Jayalath and C Tellambura, “Adaptive PTS approach for ... increased, PAPR can be further reduced Moreover, we formulate the phase weighting factors searching of PTS as a particular combination optimization problem and we apply the PSO technique to search ... Madhukumar, and F Chin, “Peak-to-average power reduction using partial transmit sequences: a suboptimal approach based on dual layered phase sequencing,” IEEE Transactions on Broadcasting, vol 49, no...
  • 8
  • 406
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A Hybrid Technique for the Periodicity Characterization of Genomic Sequence Data" ppt

Hóa học - Dầu khí

... 295–300, 1986 [23] S Tiwari, S Ramachandran, A Bhattacharya, S Bhattacharya, and R Ramaswamy, “Prediction of probable genes by Fourier analysis of genomic sequences,” Computer Applications in the Biosciences, ... Philadelphia, Pa, USA, March 2005 [17] G Dodin, P Vandergheynst, P Levoir, C Cordier, and L Marcourt, “Fourier and wavelet transform analysis, a tool for visualizing regular patterns in DNA sequences,” ... Bernaola-Galv´ n, P Carpena, R Rom´ n-Rold´ n, and J L a a a Oliver, “Study of statistical correlations in DNA sequences,” Gene, vol 300, no 1-2, pp 105–115, 2002 [6] N Chakravarthy, A Spanias,...
  • 8
  • 382
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A Simple Technique for Fast Digital Background Calibration of A/D Converters" potx

Báo cáo khoa học

... compares our technique with other proposed techniques which address the same problem STANDARD DIGITAL BACKGROUND CALIBRATION A pipeline ADC is composed of a cascade of stages that perform an analog-to-digital ... receivers for different standards can be implemented on a single hardware platform In this situation, the input to the ADC is a narrowband signal, with no information content at dc, and occupies only a ... simulations of the proposed technique in MATLAB environment, to assess its advantages over the standard technique when narrowband input signals are considered The technique has been applied to a...
  • 11
  • 398
  • 0

Xem thêm