... exclusively to female humans and animals Eg: Lion (Noun): a large powerful animal of the cat family that hunts in group and lives in parts of Africa and southern Asia Lioness (Noun): a female lion ... of plants and animals) “GRAM” – (It means “written”): telegram (a message sent by telegraph and then printed and given to somebody), grammar (the rules in a language for changing the form of ... morpheme may be defined as the minimal linguistics sign, a grammatical unit that is an arbitrary union ofa sound and a meaning and that cannot be further analyzed This definition may be too...
... collection of each blood sample, systolic (SAP), diastolic (DAP) and mean systemic pressure (MAP), mean PAP and CVP, heart rate (HR) and abnormal signs were recorded Immediately after the recording was ... (Hb) and hematocrit values (Ht) using an automatic cell counter (MEK-6248; Nihon Koden, Japan) Other blood samples were centrifuged, and plasma was collected and stored at –20 C until assay Changes ... crystalloids to obviate administration of large crystalloid volumes [5] Hiippala and Teppo [8] demonstrated that dextran produced greater plasma volume expansions than hydrocyethyl starch, and...
... typefaces, colors and the “crowded room” layout Retain the colors and hierarchies Focus on look and feel instead of slavishly repeating measurements For example, you want the banjo big and at an angle, ... measurements For example, you want the banjo big and at an angle, the type massive, the space full Note that to fit the space, the banjo has had to move around Here you can see that “playing” position ... what we want to here is place the banjo at an angle and as close to the viewer (big) as possible, leaving just enough room to squeeze in the words Tiny Giant size is daring and has in-your-face...
... managing and maintaining a mix of factors, both tangible and intangible to attract consumer loyalty (Stobart, 1994) BRAND BRAND Organizational Associations Brand Personality PRODUCT Country of ... (Aaker, 1996) 2.7 Strategic Brand Management Brand management is above all about balancing variety of inputs Balances have to be struck between the external market and internal capabilities of ... offer quality assurance and reduce risks • Brands help self-expression • Brands offer friendship and pleasure 2.3.2 A brand is more than a product Brand is more than a product Branding is about...
... upper hand, dominance, edge, head start; sway; Colloq US and New Zealand drop: After a year, the advantage was with the Royalists His height gives him an advantage at basketball gain, profit, ... accommodation at the hotel Have you seen our new office accommodation? loan, (financial) assistance or aid; grant, grant-in-aid: The man was able to obtain an accommodation from his brother-in-law accompany ... dextrous, able, masterful, masterly, polished: She is an adept pianist, and her husband is adept at carpentry n expert, master, specialist, authority , Colloq dab hand, old hand: He is an adept at anything...
... upper hand, dominance, edge, head start; sway; Colloq US and New Zealand drop: After a year, the advantage was with the Royalists His height gives him an advantage at basketball gain, profit, ... accommodation at the hotel Have you seen our new office accommodation? loan, (financial) assistance or aid; grant, grant-in-aid: The man was able to obtain an accommodation from his brother-in-law accompany ... dextrous, able, masterful, masterly, polished: She is an adept pianist, and her husband is adept at carpentry n expert, master, specialist, authority , Colloq dab hand, old hand: He is an adept at anything...
... before, which are made of ceramic material, another device mainly made of wet textile band has been designed, manufactured and characterised It is basically a cotton bandof 25 cm width and 1600 cm ... first rigorous analysis of the direct and indirect evaporative systems, considering both the advantages and disadvantages and indicating and establishing some basis about their design, was developed ... recirculated to maintain its temperature at the adiabatic saturation temperature of inlet air Because the sensible heat load is transferred to the water surface and transformed into evaporation latent...
... to the actual characteristics of the robot This means that the rough and manual tuning of the parameters of the fuzzy controller is replaced by a fine local automatic tuning and Table Angular speed ... the STFIS has the following two main advantages: Fig Concave obstacle skirting away from the target and the distance of displacement is greater than a threshold distance T; it turns back to the ... a short range from about to cm Its maximum linear speed is about 40 mm/s The robot’s linear and angular speeds are sent from a host computer via a serial link to an on-board chip, which is based...
... Graduate Management Admission Test, which is a standardized exam given at various locations in the United States and Canada and around the world Throughout North America and in many international ... as wide ofa margin as any candidate in the state’s history (A) she was reelected with as wide ofa margin as any candidate in the state’s history (B) she had been reelected with as wide ofa ... a margin as any candidate in the state’s history (C) having been reelected with as wide a margin as any candidate in the state’s history (D) she was reelected with as wide a margin as any candidate...
... operated at 60 kV accelerating voltage (Jeol, Tokyo, Japan) Images were recorded with a Gatan Multiscan 791 CCD camera (Gatan UK, Abingdon, UK) [23] Acknowledgements We would like to thank B Danielsson ... of TO activity by bis-ANS was decreased upon phosphorylation A possible explanation for this apparent discrepancy could be that PKA phosphorylation induces a conformational change that increases ... assay was reliable only within a limited range of probe concentrations), dialysis after phosphorylation was not necessary, probably because ofa lower degree of interaction of ATP with SYPRO Orange...
... from Takara Shuzo (Kyoto, Japan), Toyobo (Osaka, Japan), and New England Biolabs (Beverly, MA, USA) All other reagents were of analytical grade from Nacalai Tesque (Kyoto, Japan) and Wako Pure ... each primer (5Â-GGAAT TCCATATGTCCGCACCTTCCACCAGCACCG-3Â and 5Â-GGGAAGCTTTCAGCCAAGCAGCTCTTTCAGG-3Â), 2.5 U LA Taq DNA polymerase, and 115 ng genomic DNA from P putida ATCC12633: preincubation at ... acids tested (Table 1) The enzyme also acted on a- oxohexanoate, phenylpyruvate, a- oxobutyrate, uoropyruvate, a- oxovalerate, a- oxoisocaproate, a- oxo-octanoate, and hydroxypyruvate However, branched-chain...
... dementia, demands the existence of SMCs, preferably confirmed by an informant.3 High age, female gender and low educational level are generally associated with a higher prevalence of memory complaints.1 ... Frontal Assessment Battery Results represent mean values±standard deviation 14 women and 13 men, aged 69.6±5.4 years, with mean educational level of 8.8 years Mean MMSE score of this group was 27.8 ... digit span forward and backward and the Frontal Assessment Battery (FAB).13,14 The BCSB includes a memory test of 10 simple figures and yields different scores, namely: incidental and immediate memory,...
... necessarily mean that translation starts from a downstream AUG, as predicted by genome and mRNA analysis, but raises the possibility that the translated form may have used a CUG start codon with an ... from an 83-year-old man and a 71.0 g sampleof occipital cortex from a 85-year-old man with a short (25 h) post mortem delay RNA isolation, reverse transcription and 5Â-RACE Total RNA was isolated ... N-terminal leucine amino acid Our present study indicates that nonAUG translation initiation may be operable more often than anticipated This may have a great impact on the analysis of genes...
... performed transfection assays with increasing amounts of DNA fragments encoding cyt b5 and monitored the formation of androstadienol and DHEA As shown in Fig the stimulation of DHEA and androstadienol ... by a grant from the Canadian Institutes of Health Research The authors would like to thank Guy Reimnitz, Nathalie Paquet and Mei Wang for their technical assistance and Sylvie ´ Methot for careful ... amounts of pCMV-P450red The transfected cells were analyzed for their ability to catalyze the transformation of nM of [3H]preg into DHEA (j) and androstadienol (n) Transfections and enzymatic assays...
... many current commercial organic crop production systems An LCA modeling analysis ofa Canada-wide conversion to organic canola, wheat, soybean and corn production concluded that under an organic ... transport offers some additional, if smaller, potential for E and GHG gains (and again data for the Canadian food system is lacking) and a significant body of literature has examined relative E and ... that Canadian and North American data is particularly scarce Sustainability 2011, 335 Table Dairy—summary of organic vs conventional comparisons Authors Main [56] Olesen et al [59] Bos et al...
... ATTTCAGCAGCATACTCCACAATAAAAAG GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG AGGGAATTCATGGCGCCGCTAGACCTGGC GAGGCCTCGAGTCAAAGGAAATATGGCGTTG ... PPP6C-3¢UTR-mut-antisense PPP6C-siR-Top GACGGCTCGAGGACCAAGGGGCTGTATGCAC GCCAGAAGCTTCCTGCCCTGTTCATCTGCAGG CGGGATCCTCTTGTATTACCCTCTA GCGAATTCTCCATCGTGCC TTTTTATTGTGGAGTATGCTGCTGAAATG ATTTCAGCAGCATACTCCACAATAAAAAG ... acquisition and analysis software was used to quantify band intensities Antibodies were purchased from Tianjin Saier Biotech and Sigma-Aldrich 10 11 Statistical analysis Data are expressed as mean ± standard...
... campaign On top of that, up to 200 new examples are added each month, and all content can be easily downloaded in various formats, then tailored and presented to your team w w w.t r en d w a ... 2 TREND DATABASE This is a small sample aimed at illustrating the key features of our Trend Database (just one part of our 2013 Premium Service) Featuring all our trends (theory, stats, opportunities ... DATABA SE SA MPLE trend watching com PREMIUM 1.1 TREND DATABASE » PREMIUM GATEWAY M SA E PL w w w.t r en d w a t chin g c om | TREND DATABA SE SA MPLE trend watching com PREMIUM 1.2 TREND DATABASE...
... ATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev, 5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA TTTTTTGC-3¢ The gene mm0632 was cloned via BsaI restriction sites in plasmid pASK-IBA3 (IBA GmbH, Gottingen, Germany), ... hyperthermophilic archaeons and bacteria such as Thermotoga maritima, P furiosus and A fulgidus [5,28] In addition, homologs were found in close relatives of M mazei, such as Methanosarcina acetivorans and ... ofa monofunctional catalase from Methanosarcina barkeri Arch Microbiol 171, 317–323 39 Brioukhanov A, Netrusov A, Sordel M, Thauer RK & Shima S (2000) Protection of Methanosarcina barkeri against...