a safe and easy gene transfer method for the treatment of spinal cord injury
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... hybridization assay method only require extraction of DNA of the samples and simple incubation as well as magnetic separation, which has a good acceptability for any average lab assistant Table Comparison ... conceived of the study, and participated in its design, performed the preparation of nanomaterials and the statistical analysis All authors read and approved the final manuscript Competing interests The...
- 9
- 469
- 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot
... DP participate and analysis the study HC designed and coordinated and drafted the manuscript All authors read and approved the final manuscript Porecha et al Journal of Orthopaedic Surgery and ... each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ parents considering patient as ... literature The purpose of this study was to evaluate the midterm effectiveness of the Ponseti method [4] for the treatment of congenital idiopathic clubfoot Materials and methods A total of 49 patients...
- 7
- 531
- 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" docx
... DP participate and analysis the study HC designed and coordinated and drafted the manuscript All authors read and approved the final manuscript Porecha et al Journal of Orthopaedic Surgery and ... each for motion of the ankle and foot, position of the heel during stance, and gait For Satisfaction and Function category, data has been recorded from the patients’ parents considering patient as ... literature The purpose of this study was to evaluate the midterm effectiveness of the Ponseti method [4] for the treatment of congenital idiopathic clubfoot Materials and methods A total of 49 patients...
- 7
- 802
- 0
design, synthesis, and biological evaluation of new anti-cancer nitrogen-containing combretastatins and novel cysteine protease inhibitors for the treatment of chagas
... Derivatives of Combretastatins A- 1 and A- 4 114 Synthesis of Cold Precursors of Radio-labeled Combretastatins CA-1 and CA-4 117 Synthesis of OXi8007 and a Nitrogen-Based Indole 122 Biological and ... nitrogen-bearing analogues of combretastatins A- 1 and A- 4 (CA-1 and CA-4) is described The research work has primarily focused on the substitution of the hydroxyl groups of the B-ring of CA-1 and CA-4 ... thiosemicarbazones and unsaturated ketones which were tested against cruzain and cathepsin L in order to treat a devastating parasitic disease known as Chagas which is caused by a parasite called Trypanosoma...
- 516
- 254
- 0
A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx
... partial difference equations of three and four variables The aim of this paper is to present the generalization of this functional-analytic method for the study of linear and nonlinear partial ... details, see [11] and the references therein) Also, by assuring the existence of a solution of a difference equation in the space or , we obtain information regarding the asymptotic behavior of the ... to apply Theorem 1.1 to the preceding operator equation and obtain information for the initial linear difference equation under consideration In the case of nonlinear equations, we some manipulation...
- 12
- 257
- 0
IDENTIFICATION OF A MINIMAL CIS-ELEMENT AND COGNATE TRANS-FACTORS REQUIRED FOR THE REGULATION OF RAC2 GENE EXPRESSION DURING K562 CELL DIFFERENTIATION
... c-Fos and c-Jun (Clayton, Rose et al 2000) Protein phosphatase appears to be the histone H3 phosphatase and two kinases of the Aurora/AIK family, Aurora -A and Aurora-B, have been identified as the ... phosphate (NADPH) oxidase (Castro and Freeman 2001) The NADPH oxidases are a group of plasma membrane-associated enzymes that catalyze the production of reactive oxidants such as free radicals by the ... Sulochana devi Baskaran for helping me get through the difficult times, and for all the emotional support, friendship, and caring they provided I also want to thank my friends Nanda Kumar and Krupakar...
- 144
- 242
- 0
INTERNATIONAL STANDARD Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp docx
... case of particular products The harmonization of test methods cannot be immediate, and for certain groups of products International Standards and/ or national standards may already exist that not ... other solid selective medium complementary to XLD agar and especially appropriate for the isolation of lactose-positive Salmonella and Salmonella Typhi and Salmonella Paratyphi strains; the laboratory ... competent (for example, by an appropriate government agency) Apparatus and glassware Disposable apparatus is an acceptable alternative to reusable glassware if it has suitable specifications Usual microbiological...
- 34
- 690
- 0
Báo cáo khoa học: Re-evaluation of intramolecular long-range electron transfer between tyrosine and tryptophan in lysozymes Evidence for the participation of other residues doc
... that of the Protein Data Bank (PDB) of the Brookhaven National Laboratories Irradiated protein solutions were analysed by SDS/ PAGE and by HPLC b-mercaptoethanol was added to the irradiated samples ... the absorbance changes at 510 and 410 nm and the assumption that the extinction coefficients of the protein bound radicals and those measured from amino acids peptides are the same: for TrpÆ, these ... proteins was achieved by calculation of the portion of the total area under the curve occupied by the dimers peak The obtained value was divided by two MALDI-TOF MS was performed at The Institute of...
- 7
- 474
- 0
Pelvic floor muscle training and adjunctive therapies for the treatment of stress urinary incontinence in women: a systematic review doc
... Hay-Smith (2002) A A = available in English only as abstract; a = According to Australian National Health and Medical Research Council Hierarchy of Evidence (1998); b = Mean age (SD) unless otherwise ... quantity and quality of the educational information about the condition and PFM function The impact of these factors on the outcome of treatment has yet to be evaluated Furthermore, it has been ... with adjunctive therapy or the actual exercise dosage is the critical factor is unclear The optimal length of treatment and the number of treatment episodes could be useful information for the marketing...
- 28
- 738
- 0
a novel method for the synthesis of titania nanotubes using
... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al / ... titania nanotubular arrays were annealed in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
... colloidal particles in water the high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, ... capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15 agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... enhanced reactivity tension These substances also control both towards the toxicants makes them the potential the reduction rate of metal ions and the materials for the decomposition applications agglomeration...
- 12
- 705
- 0
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot
... with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis ... analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approved the final manuscript Acknowledgements The ... analyzed the data and prepared the manuscript VB participated in the preparation of the bone cores and exposure of the samples to the different treatments, performed the microscopic analysis and helped...
- 4
- 403
- 0
Báo cáo hóa học: " A new and efficient adaptive scheduling packets for the uplink traffic in WiMAX networks" ppt
... real-time applications and uses a cross-layer approach The deadlines calculation is made using the information about the MCSs in the PHY and the information about the BW-REQ messages sent by the ... was proposed an adaptive packets scheduling algorithm According to the backlogged traffic, the MCS, and the QoS requirements of the applications, the algorithm allocates the bandwidth in adaptive ... mechanisms to provide QoS for the downlink and uplink traffics The packets that cross the MAC layer are classified and associated with a service class The service class defines a set of QoS parameters,...
- 11
- 372
- 0
Báo cáo y học: " Pregnancy and delivery while receiving vagus nerve stimulation for the treatment of major depression: a case report" pot
... therapy for pharmacoresistent epilepsy has been http://www.annals-general-psychiatry.com/content/4/1/16 Table 1: Baseline Physical and Clinical Characteristics of the Patient Characteristic Age ... patient, a Caucasian woman aged 28 years with a DSM-IV diagnosis of unipolar depression, was enrolled in the acute and long-term phases of the pilot study of VNS therapy for TRD At acute-phase study ... period and normal spontaneous vaginal delivery with epidural anesthesia, the patient delivered a healthy daughter at full term on January 24, 2003 The infant weighed 3.1 kg and was approximately...
- 7
- 453
- 0
Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf
... because it is an index of correlation and not an index of agreement [19-21] The calculation of means and standard deviations for each SCCT item and total score during the rating by each examiner ... concentrate enough This includes the following four series’ of letters: LTPEAOAISTDALAA, ANIABFSAMPZEOAD, PAKLATSXTOEABAA and ZYFMTSAHEOAAPAT The first and third group include five A s, while the ... standard deviations for each SCCT item and total score for the rating and rerating as well as the respective plots and plots of difference vs average value for each variable suggested that the...
- 10
- 474
- 0
báo cáo khoa học: "Surgical perspectives from a prospective, nonrandomized, multicenter study of breast conserving surgery and adjuvant electronic brachytherapy for the treatment of breast cancer" pps
... shortened radiation treatment time (86%) and delivery of radiation to a smaller area of the body (77%) Twelve of the patients (27%) indicated that having a local treatment facility was a factor in their ... for treatment Factors affecting the success of implanting the balloon applicator and administering the prescribed radiation therapy were analyzed Patients answered a questionnaire after implantation ... score was 1.5 for the 20 patients who received local anesthesia, for the patient administered sedation, and 2.1 for the 18 patients who received both local anesthesia and sedation Patients were also...
- 10
- 389
- 0
Báo cáo khoa học: " Optimal organ-sparing intensity-modulated radiation therapy (IMRT) regimen for the treatment of locally advanced anal canal carcinoma: a comparison of conventional and IMRT plans" ppsx
... N2-3/T4 group Arm A, blue; arm B, brown; arm C, yellow; arm D, green Discussion Concurrent chemoradiation is the established standard of care for locally advanced carcinoma of the anal canal Attempts ... collected data, and drafted the manuscript BL, CLM, JBD, CL, and DA participated in coordination and helped to draft the manuscript SG performed the statistical analyses DA provided mentorship and edited ... III randomized trial of the European Organization for Research and Treatment of Cancer Radiotherapy and Gastrointestinal Cooperative Groups J Clin Oncol 1997, 15:2040-2049 Flam M, John M, Pajak...
- 11
- 402
- 0
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot
... on the National Cancer Institute Common Toxicity Criteria (version 2), clinical laboratory evaluations, and physical examinations OS was calculated from the date of FCR treatment to the date of ... evaluation of pheripheral or marrow blood samples for bcl2 t(14;18) translocation was performed at baseline and thereafter Safety was assessed by adverse events (AEs), with toxicity grading based ... fludarabine at a dose of 25 mg/m2 i.v on days to 3; cyclophosphamide at a dose of gr/m2 i.v on day and rituximab Page of at a dose of 375 mg/m2 was given on day of each cycle every 28 days Patients...
- 5
- 287
- 0
Báo cáo y học: "A meta-analysis of CAG (cytarabine, aclarubicin, G-CSF) regimen for the treatment of 1029 patients with acute myeloid leukemia and myelodysplastic syndrome" ppsx
... and Methods Data source The databases of PubMed, Wanfang Data, as well as American Society of Hematology (ASH) and American Society of Clinical Oncology (ASCO) annual meeting abstracts were searched ... Saito K, Nakamura Y, Aoyagi M, Waga K, Yamamoto K, Aoyagi A, Inoue F, Arai Y, Tadokoro J, Handa T et al: Low-dose cytarabine and aclarubicin in combination with granulocyte 18 colony-stimulating ... Aclarubicin is an oligosaccharide anthracycline, and an antineoplastic antibiotic It can intercalate into DNA and interact with topoisomerase I and II, thereby inhibiting DNA replication and DNA repair...
- 36
- 714
- 0
báo cáo khoa học: "Structure and expression of the maize (Zea mays L.) SUN-domain protein gene family: evidence for the existence of two divergent classes of SUN proteins in plants" pot
... Arabidopsis and rice CCSD proteins are localized at the NE The presence of a C-terminal SUN domain and the NE localization are among the defining features of animal and fungal SUN proteins [9,13,38] Plant ... Dye-normalized values for each channel generated by Feature Extraction software were divided by the median intensity for that channel on each array, and then the log base was taken, as previously ... DNA sequences (from Table 1) The mRNA coordinates for the exon bases are listed above the diagrams Exons are numbered, and the intron lengths (bp) appear below the diagrams (A) The canonical...
- 22
- 451
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25