a rose by any other name is just as sweet
Would a Roshanda by Any Other name smell as sweet
... distinctively black name whether it is a woman named Imani or a man named DeShawn—does have a worse life outcome than a woman named 172 A Roshanda by Any Other Name Molly or a man named Jake But it isn’t ... 303 174 Lauren Ashley Amanda A Roshanda by Any Other Name Megan Samantha Hannah 10 Rachel 11 Nicole 12 Taylor 13 Elizabeth 14 Katherine 15 Madison 16 Jennifer 17 Alexandra 18 Brittany 19 Danielle ... have seemed ten years ago? Most Popular Girls’ Names of 2015? Annika Ansley Ava Avery Aviva Clementine Eleanora Ella Emma Fiona Flannery Grace Isabel Kate Lara Linden Maeve Marie-Claire Maya...
- 26
- 589
- 0
Tài liệu Báo cáo khoa học: TMPRSS13, a type II transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro-hepatocyte growth factor pdf
... TMPRSS13 mRNA is expressed in a variety of human adult tissues, and predominantly in lung, placenta, pancreas and prostate [12] HAI-1 mRNA is also highly expressed in placenta, pancreas and prostate ... concentrations The IC50 value was calculated using the graphpad prism software (GraphPad Software, San Diego, CA, USA) Binding assay HAI-1–NK1 or HAI-1–NK1LK2 was mixed with various concentrations ... D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiyama O, Takahashi K et al (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth factor Biochem Biophys...
- 13
- 641
- 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... 5¢-GCTTCAGTACTTAGAGAC 5¢-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACC 5¢-GAAAAAAGGGGCCACTCAGG 5¢-T(18)GAAAAAAGGGGCCACTCAGG 5¢GCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTG 5¢-C(18)GAAAAAAGGGGCCACTCAGG 5¢-G(18)GAAAAAAGGGGCCACTCAGG ... Forward Reverse Reverse Reverse Forward Reverse 5¢-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAG 5¢-GCCATGAATATCTCCAACGAG 5¢-CATCCAAAATACGCCATGAATATC 5¢-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCG 5¢-GCTTCAGTACTTAGAGAC ... 5¢-G(18)GAAAAAAGGGGCCACTCAGG 5¢-GAATTGCTGCCGTCAGCTTGA 5¢-TAATTAACCCTCACTAAAGGGAAACGGAGCGGCACCTCTT 5¢-GCGGATCCTGGACCGCAAAAG ompA* ompA105 ompA117 5¢rpsO 5¢rpsO 3¢rpsO 3¢rpsO 3¢rpsO-(T)18 rpsO internal 3¢rpsO-(C)18...
- 10
- 488
- 0
Báo cáo khoa học: "A Rose is a Roos is a Ruusu: Querying Translations for Web Image Search" pdf
... sense disambiguated, vastly multilingual dictionary called PAN D IC TIONARY (Mausam et al., 2009) PAN D IC TIONARY is automatically constructed by probabilistic inference over a graph of translations, ... dictionary is 0.9 (evaluated based on a random sample) PAN D IC TIONARY has about 80,000 senses and about 1.8 million translations at precision 0.9 We use Google Image Search as our underlying image ... translations to a set of high-coverage languages including English, French, German, Spanish, Chinese, Japanese, Arabic, Russian, Korean, Italian, and Portuguese Additionally, we include the language as well...
- 4
- 294
- 0
Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx
... molecular mass of the CTF migrating faster than C101-3FLAG as an a- CTF within 27 Da of the calculated molecular mass Finally the same line was used to predict the molecular mass of a third FLAG-reactive ... c-secretase activity Lastly we show that zinc causes a change in the apparent molecular mass of a c-secretase substrate and inhibits c-secretase cleavage Using a purification protocol that minimized ... this column These data show that zinc can alter the apparent molecular mass of an APPderived c-secretase substrate Zinc inhibits c-secretase activity in COS7-SPC993FLAG and MC99-3FLAG based assays...
- 14
- 420
- 0
Báo cáo sinh học: " Response to mass selection when the genotype by environment interaction is modelled as a linear reaction norm" pptx
... intercept and an environment deviating SD when the variance in the slope was small (a small variance ratio, little G × E), but a larger influence with a larger variance in the slope (larger variance ratio, ... individuals of the same litter The slope of a linear reaction norm is a measure of sensitivity towards environmental change, which can be treated as a trait of the animal [8] Genetic variation ... breeding and environmental values are expressed as deviations from the average reaction norm As is common in animal breeding, covariances between residuals of different individuals and covariances...
- 20
- 172
- 0
What it is to be a leader by geoffrey byruch
... Going back and revisiting the vision as a motivator will be one of the most beneficial ways of communicating and delegating a task • Last but not least, be cognizant of the individual There is a fine ... John Quincy Adams once said that, “if your actions inspire others to dream more, learn more, more, and become more, you are a leader.”
Having a great idea and assembling a team to aid you on ... between asking and telling someone to something Make sure that you are asking Asking shows trust and understanding Telling shows micromanagement and devaluation A LEADER NEEDS TO BE CONFIDENT • Part...
- 17
- 276
- 0
Nanovation my other car is a jaguar
... curiosity is encouraged, passion is inspired, creativity is expected, and people are always talking about what’s next Ultimately, the mind-set changes so significantly that innovation is natural, and ... allow a leap of faith in their own ideas, as well as in the ideas and capabilities of their team Appitive.com vation Build a culture of innovation You need a culture where restlessness is tolerated, ... There are many others, like the one I just finished about Ratan Tata bringing out the Nano car in 2009 in India for less than $2,500 The book is called “Nanovation,” by Kevin & Jackie Freiberg Appitive.com...
- 20
- 142
- 0
Immobilization of heavy metals in sediment dredged from a seaport by iron bearing materials
... premises Medical wastes include injurious medical wastes and common wastes Injurious medical wastes are medical wastes which contain factors that can harm man’s health and environment Those factors ... infectious wastes Surgical wastes 1.2.1 Hazardous chemical wastes Expired medicine, low quality medicine Harmful chemical factor in healthcare Wastes harm cell Wastes contain heavy metal 1.2.2 ... dumping waste bags to roadsides In particular, Hanoi has thousands of medical stations, making up about 2% of total wastes Only 60 hospitals and medical centers have signed up for waste treatment...
- 10
- 722
- 0
How to write an effective biz plan a step by step guide
... nghệ châu (AITCV), Hà nội hợp tác với SEAQIP Vietnam tổ chức www.planware.org, Viết kế hoạch kinh doanh, 2001 Practical Business Planning for newventure Kế hoạch kinh doanh tài liệu tham khảo DIRECTION ... nên chuyển sang đơn vị đô-la Mỹ a tỷ giá hối đoái sử dụng Cung cấp thông tin đồng tiền nội đ a Practical Business Planning for newventure 23 tài liệu tham khảo Kế hoạch kinh doanh a Công ty phải ... vào m a hè nhiệt độ cao Practical Business Planning for newventure 35 tài liệu tham khảo Kế hoạch kinh doanh Sau số hớng dẫn giúp bạn hoàn thành bảng Sử dụng số doanh thu gần làm sở dự báo ban đầu,...
- 96
- 614
- 0
Tài liệu 20 Terabytes a Night by Doug Rosenberg with Matt Stephens doc
... looks like a nail because all we’ve got is a hammer”. In this case the nail is a use case, and the hammer is a use case diagram. Note that starting from a minimalist modeling subset and tailoring up is a very different approach from that taken by processes such as Rational Unified Process (RUP), which start with everything ... database enables a diverse multidisciplinary research program: astronomy & astrophysics; machine learning (data mining); exploratory data analysis; extremely large databases; scientific visualization; computational science & distributed computing; and ... ), which means that it was sometime in 1992 when I found myself in Greenbelt, Maryland at the NASA Goddard Space Flight Center, teaching a class on Structured Analysis and Design to the team that was re‐hosting the coprocessor software. Many people are aware that when the Hubble was first built, there was a problem with the ...
- 46
- 394
- 0
Tài liệu Define a Primary Key and Other Indexes docx
... with "LastName." Tip If you sort on multiple columns such as LastName and FirstName together, which is quite common, you could add the FirstName column underneath the LastName column in the last ... You will want to have tables where you have a lot of data and you will be deleting or updating large amounts of records at a time You also will use a field in a range situation, such as using ... Property Pages dialog box On the Indexes page, click the New button, and then fill in the following properties to add an index for the LastName field: Index Name with "IX_LastName" and Column Name...
- 5
- 383
- 0
Tài liệu The message of a master - By John McDonald pdf
... questioned as to whether we would ever see him again But here he was back again, and surely some great change had taken place in him Remarking that a miracle must have happened, he assured me that I had ... than the day I left?” I had to admit that he was both a revelation and a mystery to me He continued, “It was in a theatre in London that I met the man, or the Master, as he is called, that I am ... http://www.RetrieveALover.com Page 14 The Message of a Master Chapter IV “I was rapidly regaining my health and strength and was becoming fired with an irresistible ambition to get back and start all over again...
- 50
- 861
- 0
Tài liệu In-Building is Just What Doctors Ordered: Lima Memorial pdf
... cellular towers and base stations And the environment in a hospital is generally very “dense,” meaning that there are a lot of small rooms with walls that can block a wireless signal, and lots ... clear cellular signals anywhere in the building Case Study LOW-IMPACT INSTALLATION The job of finding a solution was assigned to Kevin Lowe, biomedical engineering technician at Lima Memorial Since ... event of a coverage problem due to a faulty antenna The deployment was fairly straightforward Contractors installed 28 remote access units (RAUs), each providing approximately 15,000 square feet...
- 2
- 201
- 0
The small business start up kit a step by step legal guide, 6 edition
... ocation, you’re l using the trade name as a mark—either a trademark or a service mark As you can see, a name can wear a bunch of different hats: It can be a trade name, a legal name, and a trademark ... legal structure that imposes ertain legal and c tax rules on its owners (also called shareholders) A corporation can be as large as IBM or, in many cases, as small as one person One fundamental ... gives a name to the partnership, then that name is the legal name Otherwise, the legal name of the general partnership is simply the last names of the owners (Many sole proprietorships and partnerships...
- 377
- 620
- 1
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose