a reconciliation of assets and liabilities recognised in the balance sheet

Transforming Your Care A Review of Health and Social Care in Northern Ireland pptx

Ngày tải lên : 07/03/2014, 04:20

... principally about money but about sustainability and clinical evidence The conclusion is clear: plan and manage the transition or accept a more haphazard set of changes In this regard there are ... areas, providing informal care and supporting the cultural and social lives of their communities.7 The health and social care system has a role in enabling older people to live as full and healthy ... Expectancy and Deprivation in Northern Ireland years, as shown in the figure overleaf Similar patterns exist in rural areas Across NI there is also variability in the health of the public Belfast...

213
489
0

A Census of Orphans and Vulnerable Children in Two Villages in Botswana pot

Ngày tải lên : 15/03/2014, 03:20

... and data management by Dr Khangelani Zuma is greatly appreciated Prof Karl Peltzer and Dr Anna Strebel for editing the final version of this report Data management was undertaking by a team of ... Maleshane Paul T Maloka Thabang S Maoeng Mantoa A Maoeng Olga Maputle Thabo B Marake Doreen K Marumo Lucia L Masekwane Granny M Mashaba Chipa J Masoka Kedibone D Matlawe Moleko E Matlawe Neo U Mbandezelo ... the care of OVC in Botswana, South Africa and Zimbabwe, a task that was jointly undertaken by SAHA and the Child, Youth and Family Development (CYFD) programme of the HSRC This was accepted and...

46
348
0

A Census of Orphans and Vulnerable Children in Two Villages in Botswana docx

Ngày tải lên : 23/03/2014, 09:20

... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free ... download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free download from www.hsrcpress.ac.za Free...

43
310
0

A Census of Orphans and Vulnerable Children in Two Zimbabwean Districts pptx

Ngày tải lên : 23/03/2014, 09:20

... Nyanga, Mutasa district, Chinhoyi, Bindura, Midlands and Mutare urban a census of ovc in two zimbabwean districts each other Bulilimamangwe, located in Matabeleland South province and bordering ... research team was accordingly split into five teams and each team was assigned a cluster to train and supervise The supervisors assisted in the training of their enumerators A summary table for the ... maternal orphans Shortage of food and lack of adequate clothing seemed to be the major problems facing the communities in Bulilimamangwe and Chimanimani Regarding the key findings in assessing...

146
422
0

Báo cáo khoa học: "Towards a model of formal and informal address in English" pdf

Ngày tải lên : 24/03/2014, 03:20

... Journal of Natural Language Engineering, 11(3):311–325 Hiroshi Kanayama 2003 Paraphrasing rules for automatic evaluation of translation into Japanese In Proceedings of the Second International ... Hwa et al., 2005; Bentivogli and Pianta, 2005) The phenomenon of formal and informal address has been considered in the contexts of translation into (Hobbs and Kameyama, 1990; Kanayama, 2003) and ... pronoun use in four European languages: Intralingual and interlingual dimensions In Proceedings of the Annual Meeting of the Australian Linguistic Society, Brisbane, Australia Ralf Steinberger,...

11
562
0

Báo cáo lâm nghiệp: "Analysis of snow accumulation and snow melting in a young mountain spruce and beech stand in the Orlické hory Mts., Czech Republic" pptx

Ngày tải lên : 07/08/2014, 04:20

... interrupted in the open area In the final stage of melting in the last decade of April, the snow melting rate in spruce reached about 26 mm/day, in beech about 28 mm/day and in the open area maximally ... Even in Finland, freezing of the soil is negligible in forests as well as on clear-cut areas if snow falls already in autumn and maintains a sufficient depth (Kubin, Poikolainen 1982) In the Czech ... (cm) the situation in the spruce stand has to be taken into account at interpreting and analyzing results of depth/weight measurements of the snowpack For the actual measurement of snow a verified...

15
348
0

Báo cáo khoa học: "Radial variations in wood mineral element concentrations: a comparison of beech and pedunculate oak from the Belgian Ardennes" pps

Ngày tải lên : 08/08/2014, 14:21

... Increasing Al concentrations and Al/Ca ratio in the wood are often regarded as reliable indicators of soil acidification because of the low mobility of Al in the wood [8, 9, 14, 21] Al concentrations ... of P, K, and Mg and increasing concentrations of N and Al in the outermost 20 rings of oak heartwood They ascribed those changes to the long-term effects of leaching of forest soil by acid rain, ... concentration gradient The “wavy” profile of Mg and K in beech, accompanied by relatively large standard deviations might indicate that such radial movements are occurring Another explanation can...

8
230
0

Báo cáo khoa hoc:" A study of association between common variation in the growth hormone-chorionic somatomammotropin hormone gene cluster and adult fasting insulin in a UK Caucasian population" doc

Ngày tải lên : 11/08/2014, 08:20

... to assess the role of CSH1.01 variation in measures of fetal and postnatal growth and adult insulin resistance, as measured by fasting insulin concentrations and Homeostasis Model Assessment of ... TMF co-ordinated the study and supervised the redrafting of the manuscript All authors read and approved the final manuscript Acknowledgements We thank Ian Day and Tom Gaunt from Southampton University ... JA, Dunger DB: Maternal-fetal interactions and birth order influence insulin variable number of tandem repeats allele class associations with head size at birth and childhood weight gain Diabetes...

7
353
0

Báo cáo y học: " Change in quality of life and their predictors in the long-term follow-up after group cognitive behavioral therapy for social anxiety disorder: a prospective cohort study" pptx

Ngày tải lên : 11/08/2014, 16:22

... a a a a a a a a a Generalized SAD -0.22* a a a a a a -0.28* a a a a a a a a a a a a a a a a Benzodiazepine use 0.23* a a a a a a a a a a a a a a a a a a a a a a a SPS (total) a a a a a a a a a ... Age: 35 yrs or older a a a a a a 0.41* a a a a a a a a a a a a a a a a a Living situation a a a a -0.32** a a a a a a a a a a a a a a a a a a a Employment a a a a a a a a a a a a -0.30* a a a ... 0.39* a 0.29* a a a a a a a a a 0.49** a a SIAS (total) SCL-90-R depression a a a a a -0.44** a a a a a a a a a a a a a -0.64** a a a a a a a a a -0.46** a a a a a a a a a a a a -0.32* -0.41* a -0.61**...

10
388
0

Báo cáo y học: " Treatment of candidemia and invasive candidiasis in the intensive care unit: post hoc analysis of a randomized, controlled trial comparing micafungin and liposomal amphotericin " pot

Ngày tải lên : 13/08/2014, 19:20

... Caucasian Asian-Indian Black Other Primary diagnosis Candidemia Disseminated candidiasis Organism Candida albicans only versus non-albicans Candida C albicans, Candida tropicalis, Candida parapsilosis, ... mortality at day and day 30 post treatment initiation A patient death during therapy was defined as treatment failure During therapy was defined as from the date of the first dose to day after the ... parapsilosis, Candida glabrata versus other Candida spp Candida parapsilosis versus other Candida spp Candida krusei versus other Candida spp Neutropeniaa at baseline Yes/No Persistent neutropenia Yes/No...

10
378
0

A study of symmetric and repetitive structures in image based modeling

Ngày tải lên : 09/09/2015, 10:17

... contained in K are called the intrinsic camera parameters and the six degrees of freedom contained in R and C are called the extrinsic camera parameters CCD cameras The ideal pinhole camera assumes ... projection, an in nite line is imaged as a line terminating in a vanishing point The vanishing point v of the normal direction to a plane is related to the plane vanishing line as l = ωv Hence we can also ... of a Euclidean coordinate system and the image plane is located at z = f The line from the camera center and perpendicular to the image plane is called the principal axis or principal ray of the...

176
1K
0

Testing a model of customer-based brand equity in the Vietnamese banking servic

Ngày tải lên : 06/11/2012, 15:52

... financial brands shows that inadequate support for the brand and, confusion and lack of understanding of branding are two important factors that constrain the success of these brands (Chernatony and ... positive and negative meaning about the brand Aaker illustrates the distinctions between a brand and a product as shown in the figure below Figure 2.2 A brand versus a product BRAND Organizational Associations ... perceived quality, 4) brand associations (which are driven by brand 11 identity: the brand as a product, the brand as an organization, the brand as a person and the band as a symbol) The fifth...

81
562
1

World Vision’s Little Book of Maternal and Child Health in the Asia Pacific pdf

Ngày tải lên : 05/03/2014, 10:20

... Thailand,Vietnam On track: China, Philippines, Solomon Isl., Sri Lanka, Thailand,Vietnam Off track: Cambodia, India, Myanmar, Papua New Guinea, Philippines, Vanuatu Off track: Bangladesh, Cambodia, ... improve the standards of maternal health has paid off, with Sri Lanka now able to report a maternal death rate around 1/10th of that of countries like Cambodia or Papua New Guinea A total of 98% of ... house in the area and inform them beforehand of the clinic day They also come on the day in case language becomes a barrier to accurate diagnosis or advice 22 Kamala is pleased to report that the...

48
673
0

AN ACCOUNT OF TIMBUCTOO AND HOUSA, TERRITORIES IN THE INTERIOR OF Africa docx

Ngày tải lên : 06/03/2014, 03:21

... Country.-Dar El Beida, Fedalla, and Rabat described. Mausoleum of the Sultan Muhamed ben Abd Allah at Rabat. Of Sheila, a Roman Town. Of the Tower of Hassan. Road of Rabat. Productive Country about Rabat. ... Tildie.-Arab Repast there. Natural Strength of Santa Cruz, of the Town of Agurem, and the Portuguese Spring and Tank there. Attempt of the Danes to land and build a Fort.-Eligibility of the Situation ... the city of Terodant and the port of Santa Cruz There is an emigration of the Mograffra Arabs, who are in possession of the country between Terodant and the port of Messa The encampments of an...

387
381
0

Báo cáo khoa học: Analysis of Lsm1p and Lsm8p domains in the cellular localization of Lsm complexes in budding yeast ppt

Ngày tải lên : 07/03/2014, 02:20

... for the latter, indicating that in the absence of an N-terminal domain distinct localization is lacking Finally, the Lsm1p Sm domain by itself (LsmDN1DCp) accumulates in both the nucleus and the ... N-terminal 10 amino acids and no other part of Lsm8p, and shows nuclear accumulation, at least when tagged at the C-terminus (Fig 4B) Finally, nuclear localization of Lsm818–GFP and failure of Lsm181p ... deﬁned as aa 122– 172 and that of Lsm8p is aa 74–109, with the remaining residues representing the central Sm domains (Figs and 2A) Fusions and deletions of the N- and C-terminal domains were...

16
515
0

Báo cáo khoa học: High and complementary expression patterns of alcohol and aldehyde dehydrogenases in the gastrointestinal tract Implications for Parkinson’s disease docx

Ngày tải lên : 16/03/2014, 11:20

... TCATCTCTGCTCTTCCACCCTCCAAAGACGCAGCCCTTCCACGTACGCC CCCAGCACAGAACACCCAGCTCTCTGGATCTCAAAATGTCAGGACAGTCCG CATCATCTCTGCTCTTCCAACCACCAAAGACGCAGCCCTTCCATGTCCG GTGATATCAGAGAACACTGTCAGGAACAAGGCTTCAGGTCACGGTCGC ... GGTTAACGGAGAGGCTTTGGGCACTGGGAGGCACCCCGACAATGACGCT TGGCCTAGAACTGCAGGAAGAGGCGTGAACAGGGATCCACTAACCGCGT CTCTCCACACTCTTCCATCCTCCAAAGGCGGTGCCTTTCCATGTGCGTC GACACTCTCCACACTCTTCCAGCCTCCAAAGGCAGTGCCTTTCCACGTG TCATCTCTGCTCTTCCACCCTCCAAAGACGCAGCCCTTCCACGTACGCC ... Adh) Adh4 (class IV Adh) Adh4 (class IV Adh) Aldh1 (class I Aldh) – Mouse Rat Rat Mouse Rat Mouse Rat Rat Rat Rat ⁄ mouse Rat ⁄ mouse ACAGCCAATGATGACAGACAGACCGACACCTCCGAGGCCAAACACGGC GGTTAACGGAGAGGCTTTGGGCACTGGGAGGCACCCCGACAATGACGCT...

12
504
0

Worldwide Investment Fund Assets and Flows Trends in the Second Quarter 2011 potx

Ngày tải lên : 16/03/2014, 17:20

... percent and 30.4 percent, respectively Brazil, Australia, Japan, Canada, China, Rep of Korea, South Africa and India follow in this ranking Taking into account nonUCITS assets, the market share of ... $ Austria Belgium Bulgaria Czech Republic Denmark Finland France Germany Greece Hungary Ireland Italy Liechtenstein Luxembourg Netherlands Norway Poland Portugal Romania Slovakia Slovenia Spain ... Netherlands, Norway, Poland, Portugal, Romania, S lovakia, S lovenia, S pain, S weden, S witzerland, Turkey and UK; 2010 data includes Ireland in money market, long-term and total net sales only...

9
417
0

Worldwide Investment Fund Assets and Flows Trends in the First Quarter 2012 pdf

Ngày tải lên : 16/03/2014, 17:20

... Poland Portugal Romania Russia Slovakia Slovenia Spain Sweden Switzerland Turkey United Kingdom Asia and Pacific Australia China India Japan Korea, Rep of New Zealand Pakistan Philippines Taiwan ... Poland Portugal Romania Russia Slovakia Slovenia Spain Sweden Switzerland Turkey United Kingdom Asia and Pacific Australia China India Japan Korea, Rep of New Zealand Pakistan Philippines Taiwan ... Poland Portugal Romania Russia Slovakia3 Slovenia Spain Sweden Switzerland Turkey United Kingdom Asia and Pacific Australia China India Japan Korea, Rep of New Zealand Pakistan Philippines Taiwan...

16
487
0