... valid design figures from a database The authentication of samples and their bounds of variation for a particular project of application is a crucial feature when contractual performance guarantees ... this condition of liquor content a portion ofthe voidage space is occupied by ambient gas, and the material may be compacted by the application of vibration and/or the application of external stresses ... special conditions apply to considerations of power, intermediate bearings, and the influence of apparently minor variations and features of construction Design variants can accommodate many of these...
... in the absence of anticoagulation therapy [13] Case presentation A 60-year-old Caucasian man was admitted to hospital for new-onset of atrial fibrillation Normal sinus rhythm was achieved after ... ventricular pacing (A pace-V sense) because of programmed, managed ventricular pacing (AAI ↔ DDD) at a heart rate of 60 beats/min The patient was discharged to home and was prescribed warfarin therapy ... leave the pacing wire in place and continue lifelong warfarin therapy To date, 40 months after insertion ofthe pacemaker, the patient remains asymptomatic with no manifestations suggestive of...
... second parts ofthe pair must be appropriately matched to each other It means that all the pairs whether they are adjacency or insertion ones contribute tothe coherence and make the conversation ... is a sequence of two utterances by different Sps in conversation The utterance ofthe first part immediately creates an expectation ofthe utterance ofthe second part ofthe same pair The second ... two persons talk to each other, one speaks after another and there is an exchange between their turns, which makes up a conversation, one ofthe most popular kinds of communication A speaker (Sp)...
... mode has axial and angular deformations, it is important to classify the vibration modes either as axial or torsional, according tothe predominant deformation The knowledge of each mode character ... increases considerably, whereas the axial decreases and the axial displacement ofthe carriage is substantially lower Nevertheless, the axial mode function amplitude has a significant value This agrees ... as the transmission ratio increases a) Axial component b) Angular component Figure : Axial an Angular components ofthe mode functions Finally, in the fourth mode, the amplitude ofthe angular...
... TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢-CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ ... Insertion of Chlamydomonas reinhardtii PSI-G into thylakoids (Lanes as in panel A) Alignment ofthe loop region of Arabidopsis and Chlamydomonas PSI-G Positively charged amino acids are shown in italics ... CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC TTGGGTCG-3¢ The two amplified fragments were used as a combined...
... that the conformational space of b-amino acids is larger than that of a- amino acids, but low-energy conformations ofthe b-amino acids backbone, corresponding to gauche rotamers around the Ca–Cb ... corresponding to h 180°, cannot overlap any conformation of a- amino acids In order to visualize onthe potential energy surfaces the conformers of b-amino acids that fit with canonical conformations ... calculations the conformers of Ac-HGly-NHMe, Ac-b2-HAla-NHMe and Ac-b3-HAlaNHMe have been generated and compared tothe canonical structures ofthe corresponding a- amino acid Ac-Gly-NHMe The corresponding...
... phosphorylated peptide ligand J Biomol NMR 23, 77–78 28 Sasaki A, Inagaki-Ohara K, Yoshida T, Yamanaka A, Sasaki M, Yasukawa H, Koromilas AE & Yoshimura A (2003) The N-terminal truncated isoform of ... inhibit any prolonged activation and rapidly return to basal SOCS levels, ready for another round of stimulation There appear to be a number of features important for effective degradation of SOCS ... (1998) The crystal structure ofthe IkappaBalpha ⁄ NF-kappaB complex reveals mechanisms of NF-kappaB inactivation Cell 95, 759–770 Domain characterization of SOCS3 34 Almrud JJ, Oliveira MA, Kern AD,...
... Somebody w a s standing onthe grass and staring up above me at the tower So there was another person out there, onthe roof ofthe tower But the person in the garden was not the ghost ofthe woman It ... dictionary They are all in this part ofthe Affer you read Who says these words? Who are they talking to? s 'She was a lady and he was only a servant! b 'You were crying: c 'F wanted to be bad: ... the lake Now I had to look up A woman was standing onthe other side ofthe lake - a dreadful woman, dressed in black She was smring at Flora I knew that she w a s the ghost of Miss Jessel, the...
... [16], and Cladophora glomerata [17]) have been determined, as has the structure of cytochrome c 6A from A thaliana [18] Together, these data represent a large volume of information about the sequences ... the Nd1H donor ofthe axial His18 and the carbonyl oxygen atom of Asn22 serves to maintain the required orientation ofthe His ring with respect tothe heme plane Interestingly, this is the only ... generously allowed or unfavorable backbone dihedral angles, and that 87.1% of all residues are in the core region ofthe Ramachandran plot The statistics ofthe refinement are shown in Table Acknowledgements...
... initial parameters associated with each rule are randomly generated subject to an admissibility constraint As long as all the rules have a non-zero probability, any string has a non-zero chance of ... splices the auxiliary tree into the target tree at a node labeled with the same nonterminal as the root and foot ofthe auxiliary tree By using a tree representation, LTAGs extend the domain of locality ... modeling ofa context-free grammar tothe level of N-grams without degrading the parsing accuracy In the future, we hope to continue to improve onthe quality of parsing and language modeling by making...
... anti-STa sera onthebiological activity of native STa, 0.5 nmol of native STa was incubated with Peptide insertions in a class A b-lactamase various dilutions ofthe sera raised with the TEM195–STa ... that are essential tothe toxicity ofthe peptide [15] When bound tothe guanylin receptor of epithelial cells ofthe calf intestine, the toxin causes fluid accumulation as a consequence ofthe ... proteins allows analysis ofthe structural organization ofthe protein in conditions more similar tothe native ones than the utilization of truncated proteins [4] Betton and co-workers have created...
... binding ofthe peptide tothe bilayer as a function of added Ab concentration The binding constant was obtained by a hyperbolic fit tothe data (solid line) with a KD value and total spectral shift as ... orifice in a Te on block, separating the silica surface ofthe PWR resonator from the aqueous compartment The hydrated silica surface attracts the polar head groups ofthe lipid to form a monolayer ... as a function ofthe concentration of Ab added tothe PWR sample compartment The binding data were fit by a single hyperbola (solid line), and the binding affinity values and the magnitude of the...
... Proceedings ofthe 1961 International Conference on Machine Translation of Languages and Applied Language Analysis (Teddington), Vol I, Her Majesty's Stationery Office, London, 1962, pp 111-121 Explanation: ... according tothe pattern of article occurrence indicated for them in the tabulation This was regarded as encouraging because, first of all, three ofthe classes were quite small compared tothe others, ... occurs as an alternative reading, an indication ofthe alternative article-less reading is to be printed along with the given article Unquestionably, the simplicity ofthe single major syntactic...
... GCA GCG TGT TGC GAT GAC GAA GAG TTT TTC GGT GGC GGA GGG CAT CAC ATT ATC ATA AAA AAG TTA TTG CTT CTC CTA CTG ATG AAT AAC CCT CCC CCA CCG CAA CAG CGT CGC CGA CGG AGA AGG TCT TCC TCA TCG AGT AGC ACT ... except the mitochondrial DNA insertion isochore in chromosome II, all other regions in A thaliana belong to GC-poor families and most ofthe variation between two adjacent regions is less than 4% Analysis ... structure ofA thaliana genome L.-L Chen and F Gao Table The codon usage, codon preference and amino acid usage ofthe genes in NOR, the mitochondrial DNA insertion isochore in chromosome II and the...
... (5'CTCGGCATGG ACGAGCTGTACAAGAAGTTGTTCACTCAGACCATGAAAGGC 3') and RG331 (5'GCC AAAGTTGATGGCGCATCCTTGATCGGCGCCAACTCCTA GAGAC 3') This fragment included 24 nucleotides from the carboxi-terminal ofthe EGFP gene ... analysis of RT-PCR amplicons from viral RNA extracted from samples ofthe supernatant of cultures according tothe passage numbering indicated on top of each lane The first lane corresponds to ... permeabilized and stained with a polyclonal antiserum against YF viral antigens (Fig 4A) The staining of YF antigens spread from the perinuclear region toa reticular network through the cytoplasm...
... Results The average age at the time of operation was 17.5 years (range – 44 years) and the average follow-up was 25 months (range, 18 – 52 months) (table 1) The average percentage of pre operative ... The average duration of Table 3: Values for duration of anesthesia, duration for operation, post operative ICU stay, ventilator support, hospital stay and documentation of infection No Diagnosis ... 16 Authors' contributions HNM has contributed in conception and design and acquisition of data, analysis and interpretation of data, drafting the manuscript and revising it critically, SWS has...
... linked to stress concentration at the tip ofthe IM nail, stress concentration at the distal locking bolt, and reaming ofthe proximal femur to accommodate the increased proximal diameter ofthe nail ... tothe anatomic axis ofthe femoral shaft (Figure 3b) The back plate ofthe femoral head steel shell had a 40 mm diameter hole to ensure unconstrained shear translation ofthe lag screw shaft ... result of dual lag screws is the substantial amount of axial medial migration ofthe inferior screw that was noted after 10,054 load cycles The axial migration of lag screws has been described as the...