a qsar for nonpolar narcosis in fish
A Build for Every Check-In
... containing information that is sent to the build master info/admin contains this Buildbot administrator’s name and e-mail address, while info/host contains a description of the slave The default ... existing installation chdir /usr/local/buildbot/slave/rsreader creating Makefile.sample mkdir /usr/local/buildbot/slave/rsreader/info Creating info/admin, you need to edit it appropriately Creating ... constants will need to be created along the way The clarity-to-maintainability ratio for the scheduler and builder sections clearly favors duplication Just as clearly, the clarity-to-maintainability...
- 36
- 423
- 0
Tài liệu Báo cáo khoa học: "A Method for Correcting Errors in Speech Recognition Using the Statistical Features of Character Co-occurrence" pptx
... ~'¢ ' "Hai arigatou gozaimasu Kyoto Kanko Hoteru yoyaku gakari de gozaimasu", ('l'hank you for calling Kyoto Kanko Hotel reservations.) Input String: -¢, "A hai arigatou gozaimasu e Kyoto Kanko ... the characters before and after "(" Cte") (3) Both the Error-Pattem-Database and String-Database can be mechanically prepared, which reduces the effort required to prepare the databases and makes ... actual utterance (A) No lacking in the meaning of the actual utterance, and with perfect expression (B) No lacking in meaning, but with slightly awkward expression (C) Slightly lacking in meaning...
- 5
- 588
- 0
Tài liệu Báo cáo khoa học: "A PROGRAM FOR ALIGNING SENTENCES IN BILINGUAL CORPORA" docx
... (Table 4) for use in lexicography (Klavans and Tzoukermann, 1990) 178 It is remarkable that such a simple approach can work as well as it does An evaluation was performed based on a trilingual corpus ... the distance scores are small, and back off to a lexical approach as necessary Signal Processing ACKNOWLEDGEMENTS We thank Susanne Wolff and and Evelyne Tzoukermann for their pains in aligning sentences ... sentences boundaries The dataset was sufficiently small that it was possible to correct the reznaining mistakes by hand For a larger dataset, such as the Canadian Hansards, it was not possible...
- 8
- 494
- 0
Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt
... seen after 26 days of culture mMCP-6 storage showed similar kinetics as for mMCP-5 In contrast, CPA protein was detected as early as after days of culture, and a maximal plateau of storage was already ... Although b-hexosaminidase activity was already detected at day 0, the intracellular content of this enzyme increased markedly after days of culture, and reached a plateau from about day 12 (Fig 2B) ... metachromatically staining granules seen in mature MCs have been poorly investigated In a recent study, we generated a mouse strain in which the SG gene was targeted [10] We found that, in the absence...
- 12
- 438
- 0
A Strategy for Cancer Control in Ireland - National Cancer Forum 2006 pdf
... be a plan for managing and monitoring the screening programme and an agreed set of quality assurance standards • Adequate staffing and facilities for testing, diagnosis, treatment and programme ... capacity of primary care; integrated care pathways and multidisciplinary teams that incorporate palliative care services 36 A formal linkage should be established between the National Cancer Forum ... cancer early, before it has had a chance to spread, remains the best strategy for reducing cancer deaths Examples of early detection include breast awareness, testicular examination and skin inspection,...
- 68
- 391
- 0
Báo cáo khoa học: "A System for Detecting Subgroups in Online Discussions" pptx
... of the ACL 2010 Conference Short Papers, pages 263–268, Uppsala, Sweden, July Association for Computational Linguistics Aditya Joshi, Balamurali AR, Pushpak Bhattacharyya, and Rajat Mohanty 2011 ... Canada, October Association for Computational Linguistics Amitava Das and Sivaji Bandyopadhyay 2011 Dr sentiment knows everything! In Proceedings of the ACLHLT 2011 System Demonstrations, pages ... 48th Annual Meeting of the Association for Computational Linguistics, pages 138–147, Uppsala, Sweden, July Andrea Esuli and Fabrizio Sebastiani 2006 Sentiwordnet: A publicly available lexical resource...
- 6
- 411
- 0
Smart Business, Social Business: A Playbook for Social Media in Your Organization
... Qantas Airlines jet airliner had crashed on Batam Island in Indonesia Qantas Airlines: No Crash, Despite Lots of Rumors After an emergency landing, rumors of a Qantas Airlines plane crash circulated ... stream does not make a business social Pointing to these accounts in marketing and advertising material also not make a business social So what, then, defines a social business? A social business ... reports from TV and Twitter it’s a Qantas airliner which crash at Batam @smillavtr: Chapter Human Capital, Evolved 17 Reports that a Qantas plane may be involved in a crash in Indonesia http://ow.ly/349sJ...
- 273
- 310
- 0
Auditing for Social Change: A Strategy for Citizen Engagement in Public Sector Accountability docx
... Financial Management Modern day public auditors perform a variety of audits aimed at satisfying different financial management goals Financial audits assess the accuracy and fairness of both the accounting ... increased, as has the demand for strong, open, and participatory monitoring, evaluation, audit, and information sharing; • Many of the existing standards and norms pertaining to ITA are either outdated ... can the media play in publicizing results of audits and advocating for citizen’s right to information? • What are the advantages and disadvantages of the audit community to adopt a media-shy attitude?...
- 220
- 373
- 1
UNDERSTANDING FISHERIES MANAGEMENT: A Manual for understanding the Federal Fisheries Management Process, Including Analysis of the 1996 Sustainable Fisheries Act doc
... are some habitat alterations that have led to habitat reduction Unfortunately, fishery managers and fishermen have had little say in habitat alterations Fishery managers are saddled with managing ... engineering and management practices, restoration of coastal areas, habitat restoration in upland areas, water quality efforts, watershed analysis/planning, and habitat creation The councils and ... of Catch and Effort Landings data are often used to suggest that there are problems in a fishery Declines in landings or increases in landings are signals that something has changed in the fishery...
- 62
- 285
- 0
Báo cáo hóa học: "A framework for ABFT techniques in the design of fault-tolerant computing systems" pot
... guarantees that faults representing errors in the processed data will result in notable non-zero values in syndrome sequence Systematic encoding means that the information bits always appear in ... operations at the data-parity level Data processing implementations are protected against Hamidi et al EURASIP Journal on Advances in Signal Processing 2011, 2011:90 http://asp.eurasipjournals.com/content/2011/1/90 ... Huang, JA Abraham, Algorithm-based fault tolerance for matrix operations IEEE Trans Comput C-33, 518–528 (1984) JY Jou, JA Abraham, Fault tolerant matrix arithmetic and signal processing on highly...
- 12
- 574
- 0
Báo cáo khoa học: "Choice of a model for height-growth in maritime pine curves" pps
... functions Seber and Wild (1989, p 118) state that "one advantage of finding stable parameters lies This transformation is made for this practical reasons but, being univariate, it has essentially no ... with a data set containing 44 trees belonging to 13 good growing stands, sampled in the Landes de Gascogne area and aged more than 35 years to get the main part of the curve This selection was made ... Chapman-Richards (Richards, 1959) variableshape functions Both curves have parameters, which have the following meanings: A asymptote; r= related to relative growth rate; m shape parameter; and...
- 10
- 280
- 0
Báo cáo y học: "A model of inflammatory arthritis highlights a role for oncostatin M in pro-inflammatory cytokine-induced bone destruction via RANK/RANK" pps
... causes profound bone damage with osteoclast formation and activation, and increased expression of RANK/ RANKL in inflammatory cells, in inflamed synovium, in articular cartilage and at the invading ... differentiation and activation induced by osteoprotegerin ligand Proc Natl Acad Sci USA 1999, 96:3540-3545 Kobayashi K, Takahashi N, Jimi E, Udagawa N, Takami M, Kotake S, Nakagawa N, Kinosaki M, Yamaguchi ... corresponding to amino acids 317–616 mapping at the carboxy terminus of RANK of human origin [H-300]) or against RANKL (rabbit polyclonal antibody raised against the epitope corresponding to amino acids...
- 8
- 380
- 0
Báo cáo y học: "Elevated extracellular matrix production and degradation upon bone morphogenetic protein-2 (BMP-2) stimulation point toward a role for BMP-2 in cartilage repair and remodeling" pps
... CCCCGAGGGCTGTGCTA TGAACTTCAACTGGAACAGGGTATC Aggrecan 0.992 2.15 TCTACCCCAACCAAACCGG AGGCATGGTGCTTTGACAGTG Collagen X 0.992 1.97 CACACTCTGTCCTCGTGCTTTG GGAATCCCTGTAAGACACACCAA Mice were injected intraperitoneally ... Therefore, the safranin O staining intensity was scored in patellar and tibial cartilage with a computerized imaging system There was a significant (30%) increase in safranin O staining intensity ... stimulation also leads to increased VDIPEN staining (k) and NITEGE staining (q,p) Arrows point to intense staining around chondrocytes FastG, fast green; SafO, safranin O Co-incubation of several...
- 11
- 401
- 0
báo cáo khoa học: " Impact of welfare cheque issue days on a service for those intoxicated in public" pptx
... Primary Access Regional Information System (PARIS) database Ethical Approval for the study was obtained from the Behavioural Research Ethics Board of the University of British Columbia Overall, ... due to the dates of welfare payments The decreased admissions right before "Welfare Wednesday" and the increased admissions starting from "Welfare Wednesday" indicate that the demand for the SU ... the individual's birthday Doing so could spread out the demand for the SU service, therefore eliminating the variability in demand This could also decrease the negative impact on Page of (page...
- 4
- 277
- 0
Báo cáo y học: " Use of cracked maize as a carrier for NDV4 vaccine in experimental vaccination of chickens" pot
... Offal as carrier for the V4 Vaccine in Nigeria According to Agbor [17] some grains (e.g maize, rice and, guineacorn) were all found to contain substances inherent in them capable of inactivating ... contributed in data analysis All authors read and approved the final manuscript Acknowledgements The authors are grateful to the Australian Centre for International Agriculture particularly the interest ... JA drafted the manuscript, carried out the various analyses, including data collection and statistical analysis GE participated in the study coordination ON participated in data collection AC...
- 5
- 285
- 0
Báo cáo y học: " Colour of sputum is a marker for bacterial colonisation in chronic obstructive pulmonary disease" pps
... Respira-SEPAR and La Marató de TV3 and Bayer Schering Pharma We thank Marta Pulido, MD, for providing an outline for this manuscript and support in editing and journal styling Bayer Schering Pharma ... study, participated in the analysis and interpretation of data and wrote the manuscript EM, JM and AT designed the study, and participated in the analysis and interpretation of data AM and SV ... meetings from Bayer and Covidien Alicia Marín, Eduard Monsó, Sara Vilà, Ramona Hervás, Cristina Esquinas, Marian Garc a, Laura Millares and Josep Morera have no conflict of interest to disclose Authors'...
- 9
- 395
- 0
Báo cáo khoa học: "Is there a place for N-acetylcysteine in the treatment of septic shock" pptx
... microcirculation and thus oxygen extraction, while at the same time attenuating inflammatory responses Prostacyclin, a prostaglandin synthesized in endothelial cells, is a potent vasodilator and an inhibitor ... platelet and leukocyte activation In septic pigs, pretreatment with iloprost, an analog of prostacyclin, increased the cardiac output, increased splanchnic blood flow and increased gastric pH In ... however, and there was also a significant increase in the cardiac index in the NAC-treated group [20] Conclusions This is an exciting time for intensivists involved in the care of patients with...
- 3
- 469
- 0
Báo cáo y học: "A role for prophylactic antibiotics in necrotizing pancreatitis" doc
... essential in pancreatic infection, just as in any other (intra-abdominal) infection Therefore, a low threshold for an aggressive diagnostic approach to ‘search for and destroy’ infection is still warranted ... a treatment modality that has no relevant side effects and that can be initiated in a timely fashion, the role of antibiotics in patients with established pancreatitis remains in the treatment ... disease Ann Surg 2007, 246:689 10 Bradley EL 3rd: A clinically based classification system for acute pancreatitis Summary of the International Symposium on Acute Pancreatitis, Atlanta, Ga, September...
- 2
- 284
- 0
Báo cáo y học: "Genomic neighborhoods for Arabidopsis retrotransposons: a role for targeted integration in the distribution of the Metaviridae" docx
... element abundance in A thaliana Wright et al [33] examined recombination rate relative to element abundance in detail and found that the abundance of most A thaliana TE families actually had a small ... RetroMap-generated datafile was used as the data source for statistical testing The data file contains chromosomal element coordinates, LTR identity, age and lineage information for all A thaliana ... coordinates Excel The here and tospreadsheet Click for application insertion identified; the data used retrotransposon analyses of eachJavaalldata fileestimate retrotransposon and RetroMap for A...
- 16
- 304
- 0
a system for managing experiments in data mining
... sampling method, the dataset is split into training data and validation data For each split, the training is done on training data and tested across the validation data The results are then averaged ... forward and can be easily understood The main entities identified are rawdata, ruledata, testdata, experimentdata Raw data contains all information about the data and attributes of the dataset ... provides a wide set of data mining algorithms which help in solving business problems Access to Oracle Database also has access to Oracle Data Mining Oracle Data Mining also helps in making predictions...
- 64
- 319
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25