a proposal of generalized plastic hinge model for the collapse behavior of steel frames governed by local buckling
Tài liệu Báo cáo khoa học: "GPSM: A GENERALIZED PROBABILISTIC SEMANTIC MODEL FOR AMBIGUITY RESOLUTION" pptx
Ngày tải lên :
20/02/2014, 21:20
... s a w the boy in the park." For instance, the "loc(ation)" feature of "park" is percolated to its mother NP node as the head feature; it then serves as the secondary head feature of its grandmother ... part of the sentences while using the remaining parts as the training set The overall performance is then estimated as the average performance of the 10 iterations Test Set: 897 Sentences Total ... is a syntax tree annotated with feature structures in the tree nodes Figure shows an example of AST The annotated version of a node A is denoted as A = A [fa] in the figure, where fA is the feature...
- 8
- 412
- 0
Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx
Ngày tải lên :
08/03/2014, 05:20
... together such that the final output takes the uncertainty in both steps together The approaches proposed by Ramshaw & Markus and Cardie&Pierce are deterministic and local, while Argamon, Dagan ... identifiers assigned to POS tags We used the approach of Katz (Katz.1987) for parameter smoothing, and build a trigram model to predict the probabilities of parameter (1) and (3) In the case that unknown ... Street Journal distributed with the Penn Treebank II, and the definition of baseNP is the same as Ramshaw’s, Table summarizes the average performance on both baseNP tagging and POS tagging, each section...
- 8
- 482
- 0
Báo cáo khoa học: "A Generalized Vector Space Model for Text Retrieval Based on Semantic Relatedness" pot
Ngày tải lên :
08/03/2014, 21:20
... are the Spearman correlation of the measures’ rankings with the gold standard (human judgements) The correlations for the three data sets show that SR performs better than any other measure of ... semantic relatedness, besides the case of (HR) in the M&C data set It surpasses HR though in the R&G and the 353-C data set The latter contains the word pairs of the M&C data set To visualize the ... follow the same pattern as the human ratings, as closely as our measure of relatedness does (low y values for small x values and high y values for high x) The same pattern applies in the M&C and...
- 9
- 394
- 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
Ngày tải lên :
28/03/2014, 15:20
... wave breaking on a natural beach To verify the accuracy of the numerical model on the simulation of the wave transformation on a natural beach, existing experimental data on the wave dynamics in ... computational time and at the moment is not suitable for a practical application. On the other hand, based on results of Nadaoka et al [9], Ting and Kirby [15‐17], it can be estimated ... verify the accuracy of the simulation by the present numerical model on the wave runup on beach, experimental data of Mase and Kobayashi [8] are used. The sketch of the experiment is shown in Fig. 10. As shown in ...
- 11
- 460
- 0
Báo cáo khoa học: A kinetic model for the burst phase of processive cellulases pptx
Ngày tải lên :
28/03/2014, 23:20
... elucidate and rationalize such interrelationships of activity and processivity Materials and methods All mathematical analysis and numerical tting were performed using the software package Mathematica ... and off rate At a xed k2, a change in this ratio may be interpreted as a change in the afnity of the enzyme for the substrate Hence, we can assess relationships of this afnity parameter and the ... examples of how the analysis of the kinetic parameters may elucidate certain aspects of the activity of Cel 7A First, we consider changes in the ratio k1S0 k3 This reects the ratio of the on rate...
- 14
- 572
- 0
A self organizing neural network model for a mechanism of pattern recognition unaffected by shift in position
Ngày tải lên :
08/07/2014, 17:02
... that of the standard pattern situated at a certain location, and that, at the same time, the lower part of this input pattern matches with that of the same standard pattern situated at another ... processes are repeatedly applied in a cascade That is, the output from one stage is used as the input to the next stage In the comparison in each of these stages, the allowance for the shift in pattern's ... the assumption that all the S-cells in the same S-plane have input synapses of the same spatial distribution, and that only the positions of the presynaptic cells shift in parallel in accordance...
- 10
- 575
- 0
Báo cáo khoa học: " A predictive model for the level of sIgA based on IgG levels following the oral administration of antigens expressed in Sacchromyces cerevisiae" pdf
Ngày tải lên :
07/08/2014, 18:21
... snoitaraperp eniccaV sdohteM dna slairetaM GgI cimetsys dna AgIs lasocum neewteb pihsnoitaler eht gnizylana yb seneg AIIxpa dna AIxpa gnisserpxe )eaisiverec S( eaisiverec secymorahccaS htiw noitazinummi ... tneiciffeoc noitalerroC sisylana lacitsitatS )ASU ,eciveD raluceloM( redaer ASILE na gnisu mn 504 ta derusaem saw eulav D.O eht ,erutarepmet moor ta noitabucni fo nim 02 retfA etalp eht ot )ASU ,daR-oiB( ... yassa nietorp ACB a gnisu derusaem erew elpmas hcae fo snoitartnecnoc nietorp latoT sisylana tneuqesbus rof Co02− ta derots dna detcelloc erew stnatanrepuS Co4 ta nim 01 rof g 000,21 ta noitagufirtnec...
- 5
- 443
- 0
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx
Ngày tải lên :
11/08/2014, 20:21
... depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary cavity in the gelatin ... size of the temporary cavity and the infiltration depth of the barium titanate particles In contrast to this, the infiltration depth of barium titanate particles in the case of the full metal jacket ... Yoganandan N, Pintar FA, Kumaresan S, Maiman DJ, Hargarten SW: Dynamic analysis of penetrating trauma J Trauma 1997, 42:266-72 Yetiser S, Kahramanyol M: High-velocity gunshot wounds to the head...
- 5
- 573
- 0
Báo cáo y học: "A novel human ex vivo model for the analysis of molecular events during lung cancer chemotherapy" pptx
Ngày tải lên :
12/08/2014, 15:20
... breaks in apoptotic cells by the TUNEL labelling assay, to further validate the importance of cleaved caspase-3 as a relevant biomarker for apoptosis In an ideal setup these data would have been ... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized ... expression of caspase-3 was analyzed by flow cytometry In a limited number of experiments, analyses of specific mRNA of caspase-3 were also performed by reverse transcriptase – polymerase chain reaction...
- 11
- 573
- 0
Báo cáo y học: " A nucleotide binding rectification Brownian ratchet model for translocation of Y-family DNA polymerases Ping Xie" pot
Ngày tải lên :
13/08/2014, 16:20
... rate to bypass a mismatched base pair as that to bypass a matched base pair Similarly, for the case of an abasic lesion located at the nth site, the interaction potential V2(x) is the same as shown ... from the Pol After the phosphodiester bond formation and then the release of PPi, except that the dsDNA segment is elongated by one base pair and the Pol has moved forwards by one base pair, the ... replication fork, the replicative Pol generally feels a backward force by the front DNA helicase [73] Thus, the slight effect of the backward force on the DNA synthesis rate by the replicative...
- 24
- 190
- 0
Báo cáo y học: " A statistical model for the identification of genes governing the incidence of cancer with age" pptx
Ngày tải lên :
13/08/2014, 16:21
... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted Number of clones 3 2 1 Time C 8 D 12 11 10 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual ... real data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted ... AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of clones 10 Number of clones Time 4 2 Time Time Figure for the...
- 9
- 372
- 0
Development of a subcortical emphasized physical human head model for evaluation of deep brain source contribution to scalp EEG
Ngày tải lên :
09/09/2015, 10:02
... to the actual scenario By using human cadavers, an anatomically accurate model can be obtained (Barth, et al., 1986; Leahy , Mosher, et al., 1998) However, the lifespan for which a cadaver can ... dendrites, capillary blood vessels and unmyelinated axons It is distributed at the surfaces of the brain Also, it forms the brain stem, thalamus and basal ganglia On the other hand, the white matter ... three layers are bound together and can move along the loose areolar tissue over the pericranium, which is adherent to the calvaria The scalp covers most of the head, starting at the top of the forehead,...
- 115
- 287
- 0
A green supply chain network design model for enhancing competitiveness and sustainability of companies in high north arctic regions
Ngày tải lên :
09/09/2015, 10:32
... of companies of this area The proposed theoretical framework and computational model aim to optimize the overall supply chain performance through balancing the trade-off among costs, risks, and ... input parameters is another focus in GrSCND Pishvaee and Razmi [37] formulate a fuzzy mathematical programming for GrSCND This model aims to balance the trade-off between costs and environmental ... environmental impacts in this study are measured by the amount of hazardous gases, i.e., CO, NO2 and volatile organic particles, generated by facility operations and transportation of goods within the...
- 16
- 340
- 0
A model for the prediction of subgrade soil resilient modulus for flexible pavement design
Ngày tải lên :
04/07/2016, 17:20
... performance database was designed to store the majority of the data collected by the LTPP program for easy and convenient dissemination and use The pavement performance database is a relational database ... SEASONAL MONITORING PROGRAM 4.1 Data Acquisition The first and foremost important task for this research was the collection of the required data that could be used for the data analysis The Transportation ... Transportation Research Board (TRB) of the National Research Council, under the sponsorship of the Federal Highway Administration (FHWA) and with the cooperation of the American Association of State...
- 104
- 423
- 0
Development of a new steady state zerodimensional simulation model for woody biomass gasification in a full scale plant
Ngày tải lên :
01/08/2016, 09:29
... mass flows) and the gasifying air temperature at the inlet of the reactor (changing the opening of the bypass valve of the air preheater) As stated above, the thermodynamic data of each stream ... internal surface of the refractory layer of the gasifier (K/W) equivalent thermal resistance of the radiative heat exchange between the cover surface of the external thermal insulation of the gasifier ... fan), the thermal power of each heat exchanger, the aperture of the control valve of the air preheater The comparison of the experimental data and the results of the simulations, that have been...
- 12
- 221
- 0
Tài liệu BONDS OF BLOOD AND HONOUR: A DUAL-STATTED INTRODUCTORY ADVENTURE FOR A GAME OF THRONES RPG WRITTEN BY JASON DURALL pptx
Ngày tải lên :
15/02/2014, 13:20
... stay away If the characters ignore them and push their way past, the bandits will allow them to pass The bandits will regroup and attack later from ambush, potentially attacking in the middle of ... honour of the father’s station • Alise died almost a decade ago of the winter sickness, and Warrick has been raised by his grandparents He works at the granary, and is well-liked by the smallfolk of ... Unbeknownst to the player characters, several hours before their departure, Ser Anders sent one of his men-at-arms, Gervas, along the way to make a deal with bandits to harass and mislead the characters...
- 24
- 446
- 1
Improving Recapitalization Planning - Toward a Fleet Management Model for the High-Mobility Multipurpose Wheeled Vehicle ppt
Ngày tải lên :
15/03/2014, 21:20
... rather than separate location variables and coefficients, and we treated the variant’s annual mileage -by- age figures as usage values in the equations After calculating EDA-based repair costs by age, ... panel-data analytic techniques As more years of data on individual vehicles become available, it may be advantageous to adopt a panel-data approach 8 Improving Recapitalization Planning: Toward a Fleet ... age, estimated odometer reading by age, annual mileage by age, estimated annual down days by age, and estimated annual parts and labor cost by age VaRooM also required economic parameters as inputs—specifically,...
- 92
- 499
- 0
Báo cáo khoa học: "Jointly optimizing a two-step conditional random field model for machine transliteration and its fast decoding algorithm" pdf
Ngày tải lên :
17/03/2014, 00:20
... optimization We denote a word in the source language by S, a segmentation of S by A, and a word in the target ˆ langauge by T Our goal is to find the best word T in the target language which maximizes ... generate top-10 results for both steps to approximate the Equation 3.3 P (Aj |S) (3) j=1 The meaning of this formula is that the probability of all the remaining candidates is smaller than the ... Japanese, and it is impossible to list all the candidates Our analysis shows that beyond the 10th candidate, almost all the probabilities of the candidates in both steps drop below 0.01 Therefore...
- 6
- 419
- 0
Báo cáo khoa học: "A Novel Burst-based Text Representation Model for Scalable Event Detection" pptx
Ngày tải lên :
23/03/2014, 14:20
... consisting of 24 significant events and 40 moderate events.6 4.3 Evaluation metrics and baselines Similar to the evaluation in information retrieval , given a target event, we evaluate the quality of the ... one day is treated as a batch 44 et al., 2004) ,we parameterize p0 and p1 with the time index for each batch, formally, we have p0 (t) and p1 (t) for the tth batch Given a term w, we use a sliding ... “relevant” documents by systems We use average precision, average recall and mean average precision(MAP) as evaluation metrics A difference is that we not have queries, and the output of a system...
- 5
- 1.1K
- 0
Báo cáo sinh học: " An advanced Bayesian model for the visual tracking of multiple interacting objects" pptx
Ngày tải lên :
18/06/2014, 22:20
... arbitrary data association distributions in a natural way, establishing a compromise between the computational cost and the accuracy in the estimation In practice, the performance of the particle ... can be acceptably simulated by a constant velocity model with Gaussian perturbations if the object occlusions and the data association are known That is, if the main sources of non-linearity and ... dynamics and for the data association The presented tracking model achieves to successfully track the objects because it is able to compute and manage several hypotheses of object behaviors and...
- 38
- 394
- 0