0

a preliminary study on ornamentation and ultrastructure of mesozoic and cenozoic ostracoda in china

evolutionary biology of ostracoda

evolutionary biology of ostracoda

Sinh học

... The application of Ostracoda to location of non-marine Jurassic-Cretaceous boundary in Sichuan Basin of China 1245 BODERGAT, A. -M and DONZE, P Biostratigraphical scale in the Toarcian of the Paris ... Ise and Mikawa A N bays, Pacific coast of central Japan 413 T TABUKI, and NOHARA, Preliminary study on the ecology of ostracods from R the moat of a coral reef off Sesoko Island, Okinawa, Japan ... adaptations of Ostracoda to microhabitats in Zostera beds 303 IKEYA, and UEDA,H Morphological variations of Cytheromorpha acupunctata N (Brady) in continuous populations at Hamana-ko bay, Japan...
  • 1,373
  • 2,110
  • 0
Tài liệu Physiologic variations of serum tumor markers in gynecological malignancies during pregnancy: a systematic review pptx

Tài liệu Physiologic variations of serum tumor markers in gynecological malignancies during pregnancy: a systematic review pptx

Sức khỏe phụ nữ

... between inhibin A and B Due to the diverse study designs and conditions and use of different assay methods with different intra -and interassay coefficients of variation, a meta-analysis was not ... 53% of patients with squamous cell carcinomas of the head and neck, esophagus, and lung, and also in between 8% and 42% of patients with adenocarcinomas of the ovary and uterus [38] SCC is probably ... conclude that SCC is an oncofetal antigen [39] The analysis of in vitro culture of amnion cells and amniotic membranes revealed no accumulation of SCC in the supernatant, and no mRNA expression...
  • 10
  • 849
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Distribution and variations of potassium and calcium in different cross sections of Picea abies Karst needles and Fagus sylvatica (L) leaves exposed to ozone and mild water stress" docx

Báo cáo khoa học

... clones and calcium and potassium in beech only The interaction of drought and ozone had a significant effect on calcium levels in the Istebna clone and potassium levels in Gerardmer and beech As ... cells, layer of cells on a sheet of aluminium were analysed All measurements were made using an X-ray take-off angle of 45°, a measuring time of 100 s, a magnification of 000 for all examined tissues ... cause increasing K concentrations (Schier, 1990) and Cape et al (1990) found that increasing K was due to a mechanism to maintain cationic balance In contrast to Norway spruce, beech showed decreasing...
  • 12
  • 299
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: "Effects of soil temperature on gas exchange and morphological structure of shoot and root in 1 yr old Scots pine (Pinus sylvestris L.) seedlings" pot

Báo cáo khoa học

... decrease occurred in seedlings at a changing soil temperature (Table I) The transpiration rate increased in seedlings at constant 12°C during the first 11 d and then declined sharply (Fig 2) At constant ... constant 8.7°C, the transpiration rate remained at the same level for 11 d and then declined The transpiration rate in seedlings at changing soil temperature increased slightly and then decreased ... temperature affected gas exchange pine seedlings In general A and E were higher in warm than in cold soil At a changing soil temperature, the situation is more complicated The net assimilation rate...
  • 5
  • 310
  • 0
Báo cáo y học:

Báo cáo y học: "Three variations of the laryngeal nerve in the same patient: a case report" potx

Báo cáo khoa học

... variations The coincidence of a right non-recurrent ILN and bilateral bifurcation of both nerves is a very interesting feature SILAB is a rare additional finding as a third anatomic variation ... coincidence of a right nonrecurrent nerve and bilateral bifurcation of both right and left nerves in the same patient is a very interesting feature SILAB appeared as additional third variation of RLN in ... anatomic variation [6,8] On the other hand, extra-laryngeal terminal division of RLN is a common variation macroscopically Figure Left RLN bifurcated at artery and nerve crossing point A horizontal...
  • 5
  • 492
  • 0
Molecular and morphological phylogenetics of the faviidae (scleractinia) in singapore

Molecular and morphological phylogenetics of the faviidae (scleractinia) in singapore

Tổng hợp

... water and dried The COI gene was amplified using Scleractinia-specific primers MCOIF(5'–TCT ACA AAT CAT AAA GAC ATA GG–3’) and MCOIR (5'–GAG AAA TTA TAC CAA AAC CAG G–3’) with the protocol of ... 3.1; Appendix III) Two non-faviid specimens—Acanthastrea echinata (Mussidae) and Scapophyllia cylindrica (Merulinidae)—were also obtained as outgroup taxa (criterion based on conventional classification; ... 200 4a) COI was amplified with Scleractinia-specific primers MCOIF(5'–TCT ACA AAT CAT AAA GAC ATA GG–3’) and MCOIR (5'–GAG AAA TTA TAC CAA AAC CAG G–3’) using the following protocol: 95°C for min,...
  • 152
  • 368
  • 0
Báo cáo y học:

Báo cáo y học: "Treatment of Chronic HCV Infection in Special Populations."

Y học thưởng thức

... 2003;38(1) :A6 26 27 Bruno R, Sacchi P et al Viral dynamics and pharmacokinetics of peginterferonalpha- 2a and peginterferon alpha-2b in naïve patients with chronic hepatitis C: a randomized, controlled study ... with 27% in cirrhotics and 14% in African Americans The results of RENEW trial of induction dosing using pegylated alpha 2b plus ribavirin in 650 interferon alpha 2b plus ribavirin non-responders ... Comparison of African American and Non African American patients SVR for PEG-IFN alpha + weight based ribavirin non-responders retreated with IFN alpha + weight based ribavirin In: AASLD Abstract 172;...
  • 6
  • 389
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

Hóa học - Dầu khí

... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... gccagcccccuguugggggcgacacuccaccauagaucacuccccugugaggaacuacugucuucacgcagaaag domain I g g domain II 100 150 cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain II a g u u c 200 gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu ... Adult Adult 29 Adult Adult Male Male Female Female Female Female Female Male Female Female Female Female Male Male Female Male Male Male Male Male Male Male Male Male Male Male Male Male Female...
  • 12
  • 354
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "The rate of Salmonella spp. infection in zoo animals at Seoul Grand Park, Korea" docx

Báo cáo khoa học

... Brown capuchin Celebes macaque Crab eating macaque De Brazza's monkey Formosan macaque Lion tailed macaque Mandrill Mangabey Mona monkey Moor monkey Orangutan Patas monkey Equus caballus przewalskii ... faced Capuchin White handed gibbon White-cheeked gibbon Macaca nemestrina Macaca mulatta Cercopithecus aethiops Macaca sinica Cebus capucinus Hylobates lar Hylobates concolor 10 2 Guanaco Lama ... przewalskii przewalskii − Papio anubis Ateles paniscus Ateles geoffroyi Macaca radiata Cebus apella Macaca nigra Macaca fascicularis Cercopithecus neglectus Macaca cyclopis Macaca silenus Papio...
  • 5
  • 548
  • 0
báo cáo khoa học:

báo cáo khoa học: "Changes in the distribution of the genetic variance of a quantitative trait in small populations of Drosophila melanogaster" docx

Báo cáo khoa học

... genetic variance in the offspring generation and increase the variance among lines From the virgin females scored at generations and 10 in both experiments and at generation in experiment 1, one generation ... estimates of CV(V rests on the assumption of both general and t) A special environmental variances being the same in all lines at a given generation, although they may change from one generation ... lines) For each line and direction of selection, the females selected were mated to males taken at random from that same line and generation and 20 female offspring were scored Realized heritabilities...
  • 10
  • 370
  • 0
Báo cáo y học:

Báo cáo y học: "Mixture modeling of transcript abundance classes in natural populations" ppsx

Báo cáo khoa học

... hierarchical clustering of abundance of all transcripts in NC and Two-way hierarchical clustering of abundance of all transcripts in NC and CA samples The heat map indicates relatively high abundance in ... proportional to the level of variation within populations, and this observation motivates the development of quantitative measures of transcriptional variation among individuals Transcriptional population ... CA sample of inbred lines This work was supported by NIH award P01-GM45344 to GG interactions The following additional data are available with the online version of this paper Additional data...
  • 14
  • 211
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Detection and modelling of time-dependent QTL in animal populations" doc

Báo cáo khoa học

... investigated in a simulation study and a real example of protein yield in dairy cattle MATERIALS AND METHODS As in the traditional quantitative genetics model for analysing functionvalued traits, ... with a rapid increase to a maximum production peak early in lactation and then declines gradually to the end of lactation This reflects dramatic changes in the physiological state of dairy cattle ... biological interpretation in terms of peak of production and persistency, and a QTL analysis was performed on these parameters using single-marker and interval mapping models Moreno et al [19]...
  • 18
  • 185
  • 0
A study on the attitudes of 12th grade students in listenning lessons at a high school in Bac Ninh province = Nghiên cứu thái độ của học sinh lớp 12 trong

A study on the attitudes of 12th grade students in listenning lessons at a high school in Bac Ninh province = Nghiên cứu thái độ của học sinh lớp 12 trong

Sư phạm

... responding, and creating meaning through involvement, imagination and empathy In other words, linguistic knowledge and world knowledge interact as listeners create a mental representation of what ... realities and are arranged in a certain theme, including 16 units and reviews The lessons are distributed and arranged in appropriate sequence with each unit corresponding to a particular topic and ... teaching method and use teaching aids and motivational strategies infrequently In addition, difficult listening tasks, the discouraging class atmosphere and poor teaching facility also impair...
  • 74
  • 541
  • 0
Effectiveness of Indirect Corrective feedback in English writing at the Faculty of English, Hanoi National University of Education =Hiệu quả của chữa lỗi gián t

Effectiveness of Indirect Corrective feedback in English writing at the Faculty of English, Hanoi National University of Education =Hiệu quả của chữa lỗi gián t

Sư phạm

... writing 1.1.1 An overview of process approach Since early 1970s, what is now called the writing process has been taken into consideration as an approach of teaching writing Nowadays there is a ... basic stages such as planning, drafting, revising, and editing, and four other stages externally imposed by teachers, namely pre-writing, responding, evaluating and post writing This distinction is ... passed an institutional entrance exam into Hanoi National University of Education They started learning English at secondary school and now they are the second-year students at university Most of...
  • 57
  • 741
  • 0
nonverbal communication study on the application of classroom seating arrangements in academic setting at Hanoi School of Public Health Nghiên cứu giao tiếp phi

nonverbal communication study on the application of classroom seating arrangements in academic setting at Hanoi School of Public Health Nghiên cứu giao tiếp phi

Giáo dục học

... diagram: COMMUNICATION Verbal communication Intralanguage - Lexicon - Rules of grammar - Rules of phonetics - Rules of language use and interaction skills -… Nonverbal communication Paralanguage ... decisions, and meeting The discussion style has similar teamwork style characteristics such as the sharing of information and brainstorming Instructors also allocate certain amounts of discussion ... communication styles and classroom seating arrangements Seating arrangements are a main part in a teacher‟s plan for classroom management Not only the teachers need to consider the physical arrangement...
  • 57
  • 608
  • 0
Báo cáo y học:

Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"

Y học thưởng thức

... plant-source calcium as a stand-alone product Authors’ Contributions Kaats GR was the principal investigator; he secured and audited all study data, conducted all of the statistical analyses, and contributed ... vitamin D J Gastrointest Surg 2005;9:1106-1110 33 Baxter-Jones ADG, Kontulainen SA, Faulkner RA, Bailey DA A longitudinal study of the relationship of physical activity to bone mineral accrual ... supervision Keith SC conducted DXA testing, aided in study design, preparation of the Informed Consent and computerizing of all study data Keith PL also aided in study design, preparation of the Informed...
  • 12
  • 663
  • 0
TEMPORAL VARIATIONS OF POLLUTANT LOADS DURING STORM EVENTS IN A SMALL RIVER BASIN

TEMPORAL VARIATIONS OF POLLUTANT LOADS DURING STORM EVENTS IN A SMALL RIVER BASIN

Môi trường

... level at the recession stage Ion concentrations decreased during the rising stage and increased again at the recession stage, indicating that ions were diluted by the major runoff (3) Relationships ... J Water Pollut Control Fed., 252-264 Standard Methods for Examination of Water and Wastewater (1998) 20th edition, American Public Health Association / American Water Works Association / Water ... Na2CO3/0.3mM NaHCO3 F- , BrHCO3mg/L Equivalent by alkalinity, Alkalinity: Titration method (*2320 B) Analytical methods are numbered in Standard Methods for the examination of water and wastewater -...
  • 8
  • 374
  • 0
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge

Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge

Môi trường

... SVI gradually decreased due to aerobic granulation, as shown in Figs and As sludge settling ability increased, surface loading and aeration rates were gradually increased, and finally set at 1.8 ... aeration rates Formation of Aerobic Granular Sludge by Controlling Surface Loading and Aeration Rates Surface loading and aeration rates were initially set at 1.2 m3/m2/d and 0.30 L/min, respectively, ... aerobic granulation in a continuous-flow reactor Both surface loading and aeration rates affect the selection of well-settling sludge and the formation of aerobic granular sludge By setting and...
  • 8
  • 481
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Use of Mutual Information Based Character Clusters in Dictionary-less Morphological Analysis of Japanese" ppt

Báo cáo khoa học

... Having a way of organizing classes of characters is clearly an advantage in describing facts in Japanese The next section presents such a method Mutual Information-Based Character Clustering One ... morphological analyzer processes each character in a string from left to right Candidates for a word are examined, and a tag candidate is assigned to each word When each candidate for a word is ... probable candidates The fact that we not use a dictionary, 13 is one of the great advantages By using a dictionary, a morphological analyzer has to deal with unknown words and unknown tags, 14 and...
  • 5
  • 413
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008