a portion of the script pane shows the function called makered which changes the text field called blinkingsign to a red forte font
Báo cáo khoa học: "Adenocarcinoma of the third portion of the duodenum in a man with CREST syndrome" pot
Ngày tải lên :
09/08/2014, 07:21
... depicting a mass Computed tomography of the abdomen depicting a mass (arrows) in the duodenum was carried out Histological examination revealed a lowgrade duodenal adenocarcinoma of maximal diameter ... has been stated that primary duodenal adenocarcinoma is one of the main causes of death in patients with FAP [11] A case of an early duodenal adenocarcinoma from a Brunner's gland has been reported ... 50:636-641 Akino K, Kondo Y, Ueno A, Yamazaki K, Hosokawa M, Shimozi H, Adachi T, Honda S, Ichiyanagi S, Akahonai Y, Fujisawa Y, Takahashi H, Arimura Y, Endo T, Imai K: Carcinoma of duodenum arising...
- 4
- 202
- 0
Tài liệu BANKING ON OPPORTUNITY: A SCAN OF THE EVOLVING FIELD OF BANK ON INITIATIVES docx
Ngày tải lên :
16/02/2014, 06:20
... Opportunity A Scan of the Evolving Field of Bank On Initiatives A Scan of the Evolving Field of Bank On Initiatives San Francisco, CA San Jose, CA Santa Ana, CA Savannah, GA Seattle-King County, WA St ... cases, as alternatives Gaps within the Financial Access Field Although a basic transactional bank account can be considered the primary point of entry into the financial mainstream, unbanked and ... Sacramento, CA 44 January 2010 Russell Fehr City of Sacramento Rfehr@cityofsacramento.org www.bankonsacramento.ca.gov US DEPARTMENT OF THE TREASURY Office of Financial Education and Financial Access Banking...
- 97
- 460
- 0
Tài liệu Báo cáo khoa học: A tyrosinase with an abnormally high tyrosine hydroxylase/dopa oxidase ratio Role of the seventh histidine and accessibility to the active site docx
Ngày tải lên :
19/02/2014, 07:20
... eliminate the characteristic lag period of tyrosinases [8,20,21] Figure shows the rate of TH activity as a function of the concentration of l-dopa cofactor added to the assay mixture R3-1501– extracts ... tyrosinase from Rastonia solanacearum environmental pH, may also affect the expression of the most appropriate enzyme Apart from the physiological roles and environmental advantages of having several ... A novel tyrosinase from Rastonia solanacearum ´ D Hernandez-Romero et al A B C particular catechol to o-dopaquinone is also called dopa oxidase (DO) activity On the other hand, laccases...
- 14
- 849
- 0
A Review of the Medical Benefits and Contraindications to Breastfeeding in the United States ppt
Ngày tải lên :
05/03/2014, 10:20
... their toxins and are capable of activating the alternate complement pathway 55 The normal flora of the intestinal tract of the breastfed infant, as well as the offspring of all other mammalian ... Nagata I, Shiraki K, Tanimoto K, Harada Y, Tanaka Y, Okada T 1992 Mother -to- infant transmission of Hepatitis C virus Journal of Pediatrics 120:432–434 78 Ogasawara S, Kage M, Kosai K, Shimamatsu ... defense of the neonate and the intestinal flora Acta Paediatrica Scandinavica 351(Suppl.):122–125 Pisacane A, Graziano L, Zona G, Dolezalova H, Cafiero M, Coppola A, Scarpellino B, Ummarino M, Mazzarella...
- 40
- 816
- 1
Stress and Performance - A Review of the Literature and Its Applicability to the Military pdf
Ngày tải lên :
29/03/2014, 18:20
... in the face of stress For cases in which moderators could be both types, the author classified each moderator into what appears to be the most common manifestation of the moderator In the remainder ... value attainment, and job satisfaction by including a tension-squared term as a predictor variable in their model They find that the tension-squared term has a statistically significant relationship ... represent the primary areas of functioning affected by stress, according to the literature in this field, and second, they are particularly relevant to the military context and to the completion of...
- 86
- 607
- 0
maxwell jc - a dynamic theory of the electromagnetic field
Ngày tải lên :
04/06/2014, 12:44
... perpendicular to the current and to the lines of force, is measured by the area of the parallelogram formed by and proportional lines parallel to the current to their intensities Mechanical Force on a ... produces a state of polari- parts similar in distribution to the polarity of the parts of a mass of iron under the influence of a magnet, and like the magnetic polarization, capable of being ... final value t is great, is (14) JLV The value of the integral of x2 with respect to the time is ^dt=m+ {a- b)h^^j The actual current changes gradually from the initial value a to the final value...
- 54
- 350
- 0
Báo cáo sinh học: " Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" pptx
Ngày tải lên :
18/06/2014, 19:20
... These are ongoing, and the first oncolytic viral therapy has now been approved in China as a treatment for head and neck cancers [19] Clinical trials are underway to assess Haddad et al Journal of ... Valencia, CA) The mRNA samples were measured by spectrophotometer for proof of purity and hybridized to HG-U13 3A cDNA microarray chips (Affymetrix Inc, Santa Clara, CA) by the genomic core laboratory ... viral therapy is emerging as a novel cancer therapy Preclinical and clinical studies have shown a number of oncolytic viruses to have a broad spectrum of anti-cancer activity and safety [18] These...
- 14
- 490
- 0
báo cáo hóa học:" Insertion of the human sodium iodide symporter to facilitate deep tissue imaging does not alter oncolytic or replication capability of a novel vaccinia virus" potx
Ngày tải lên :
20/06/2014, 03:20
... These are ongoing, and the first oncolytic viral therapy has now been approved in China as a treatment for head and neck cancers [19] Clinical trials are underway to assess Haddad et al Journal of ... Valencia, CA) The mRNA samples were measured by spectrophotometer for proof of purity and hybridized to HG-U13 3A cDNA microarray chips (Affymetrix Inc, Santa Clara, CA) by the genomic core laboratory ... viral therapy is emerging as a novel cancer therapy Preclinical and clinical studies have shown a number of oncolytic viruses to have a broad spectrum of anti-cancer activity and safety [18] These...
- 14
- 393
- 0
Báo cáo lâm nghiệp: "The route of the pollen tube from stigma to ovule in Populus nigra : a new look" docx
Ngày tải lên :
09/08/2014, 06:22
... preparation system After rapid freezing, fresh pistil samples are fractured at low temperature before observation The visualization of the pollen tube progress in this cavity has raised the general ... at the base of the funiculus strongly suggests that part of the ovule may be chemotropically active towards the pollen tube Moreover, these two physiological methods have enabled us to establish ... Inter,!ectional incompatibility in Populus PhD thesis, Australian Nation3 Univ Canberra, Australia tsoN ARR -H ESLOP H J., H Y., 1970 Evaluation of pollen viability by enzymatically ARRISON -H...
- 6
- 310
- 0
Báo cáo y học: " Use of the novel hemostatic textile Stasilon® to arrest refractory retroperitoneal hemorrhage: a case report" pps
Ngày tải lên :
11/08/2014, 14:21
... for external and internal use and has been granted over -the- counter status making it available without a prescription Although Stasilon® has been cleared for up to 30 days of implantation, we ... laparotomy and suture ligation, aggressive correction of associated coagulopathy and thrombocytopenia, sequential attempts at cotton-based packing, visceral angiography, and ultimately splenectomy ... design, the surgery, and manuscript preparation CD participated in the study design and manuscript preparation, VB, DO, SJ, and BC participated in the study design and surgery All authors read and approved...
- 5
- 389
- 0
Báo cáo y học: "A systematic review of the international published literature relating to quality of institutional care for people with longer term mental health problems" potx
Ngày tải lên :
11/08/2014, 17:20
... considered the most important factor in the amount of time the staff spent with that patient [111] The likeability of staff is also important to the therapeutic alliance and has been shown Page 23 of ... clarity of the research question or hypothesis, the type of methodology used [16] and relevance of the participants to the aims of the review); (4) data analysis (which included clarity of the analysis ... and organisational factors The professional background of staff may influence their therapeutic relationships due to their training, the theories underpinning their profession and the types of...
- 30
- 476
- 0
Báo cáo y học: "Use of the probiotic Lactobacillus plantarum 299 to reduce pathogenic bacteria in the oropharynx of intubated patients: a randomised controlled open pilot study" pps
Ngày tải lên :
13/08/2014, 11:23
... investigator and did most of the planning and performance of the study BK handled the primary data and did most of the statistical work, and also collaborated with GM, BJ and AL to prepare and finalise the ... collected daily and analysed at the hospital clinical chemistry laboratory Enteral nutrition was started and increased according to the department's protocol The amount of enteral formula given and the ... manuscript GM contributed substantially to the analysis of the results of the bacterial cultures and completion of the manuscript BJ took part in planning of the study and in finalising the manuscript...
- 8
- 389
- 0
GUARANTEE OF THE ACCUSED PERSON’S RIGHT TO DEFENSE COUNSEL a COMPARATIVE OF VIETNAMESE, GERMAN AND AMERICAN LAWS
Ngày tải lên :
15/08/2014, 15:50
... closely attaches to the history of formation of a fair adversariality (a particular of the adversarial model) The defense counsel plays the role of assisting the accused at the court to oppose the accusations ... laws that is the balance between the task of handling crimes and maintaining the strictness of laws and the guarantee and nonviolation of the procedural rights of the accused Practically, in a ... purpose of acknowledging the strengths and weaknesses of applying laws in each nation Finally, on the basis of studying theoretical foundations and applicable laws as well as the practical application...
- 33
- 430
- 0
The force of law toward a sociology of the juridical field (Pierre Bourdieu)
Ngày tải lên :
16/02/2016, 09:22
... such a rhetoric of autonomy, neutrality, and universality, which may be the basis of a real autonomy of thought and practice, is the expression of the whole operation of the juridical field and, ... seen as the source of its universal applicability) He associated the development of a body of legal specialists, and of juridical scholarship adapted to making the law an abstract and logically ... equally at the heart of the ideology that tends to see the law as an instrument for the transformation of social relations The analyses offered earlier in this Essay allow us to understand that...
- 49
- 680
- 0
Tài liệu THE STORY OF THE YOUTH WHO WENT FORTH TO LEARN WHAT FEAR WAS -GRIMM''''S FAIRY TALE pptx
Ngày tải lên :
21/01/2014, 03:20
... see about a place for you.’ The youth went with the waggoner, and in the evening they arrived at an inn where they wished to pass the night Then at the entrance of the parlour the youth again said ... went to it and took the lid off, and a dead man lay therein He felt his face, but it was cold as ice ‘Wait,’ said he, ‘I will warm you a little,’ and went to the fire and warmed his hand and laid ... shall at once go into your coffin again,’ and he took him up, threw him into it, and shut the lid Then came the six men and carried him away again ‘I cannot manage to shudder,’ said he ‘I shall...
- 14
- 467
- 0
Tài liệu The Best of the World''''s Classics, Restricted to Prose, Vol. VII doc
Ngày tải lên :
18/02/2014, 06:20
... on the bank whereof was situated the tower called Arctic Going toward the east there was another called Calổr, the next following Anatole, the next Mesembrine, the next Hesperia, and the last ... Prince's battle, the archers there stood in manner of a herse and the men of arms in the bottom of the battle The Earl of Northampton and the Earl of Arundel with the second battle were on a wing ... ride abreast all up to the very top of all the palace From the tower Anatole to the Mesembrine were fair great galleries, all painted with the ancient prowess, histories, and descriptions of the...
- 102
- 435
- 0
Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc
Ngày tải lên :
07/03/2014, 10:20
... CATGAAGCTTGCATGGCCGGGGCC (located upstream of furS) CGAGAATTCGAAAACGAACGGTGC (located upstream of furS and ending at the 5¢-end of binding site I) GTTGAATTCTCGTGTTTATGAGGG (located upstream of ... furS and beginning at the 3¢-end of binding site I) GGAGCTGCAGCCCACGCGATCGCG (located downstream of the start codon of furS) GGTAAGCTTCTCCAGGGTCAGATG (located upstream of hbpS) GCCGAATTCTCCTCAGCATGTCCAG ... controls the alkaline phosphatase gene (phoA) and other phoA-related genes [14,15] To date, however, the phosphorylation cascade between a Streptomyces SK and its cognate RR leading to altered DNA-binding...
- 14
- 428
- 0
MATHEMATICS REVISED BASED ON THE RECOMMENDATIONS OF THE TEXT BOOK DEVELOPMENT COMMITTEE pptx
Ngày tải lên :
08/03/2014, 12:20
... vectors: Vectors are said to be coplanar if they are parallel to the same plane or they lie in the same plane Negative vector: → The vector which has the same magnitude as that of a but opposite ... a = 22 33 − a3 2 a2 3 32 a3 3 a2 2 a2 3 = a2 2a3 3 − a3 2 a2 3 a3 2 a3 3 Cofactor of a1 1 is A1 1 = (−1)1 + M11 = a2 1 a2 3 = a2 1 a3 3 − a3 1a2 3 a3 1 a3 3 (ii) Minor of a1 2 is M12 = a2 1 a2 3= ... a2 3= (a a Cofactor of a1 2 is A1 2 = (−1)1+2 M12 = − a − 21 33 − a2 3 a3 1) 31 a3 3 16 (iii) a2 1 a2 2 Minor of a1 3 is M13 = a = a2 1 a3 2 − a3 1 a2 2 31 a3 2 a2 1 a2 2 Cofactor of a1 3 is A1 3...
- 100
- 312
- 0
Báo cáo Y học: Cloning, chromosomal localization and characterization of the murine mucin gene orthologous to human MUC4 pdf
Ngày tải lên :
08/03/2014, 23:20
... TCTACgtgagtccgg ACCAGgtgagtcatt atgtgctcagTTCAC cctttcctagGAATA ATCAGgtgagccttt TTGGGgtgagtggat cctttcctagGAATA caacttccagACCAA TCGGGgtgagtagac TCCAGgtaagatcgg ccacccccagAGCAA ttgcctgcagTGGAG ... tttcaagaagATGCT CTCAGgtgagtcagc ttcactccagGAACC ccatgtccagGATTG ATCAGgtagctgcca TCAGGgtaagtgata acgtgtccagGAATG ccttgtctagGCATT GAGAGgtgaggccat TCTACgtgagtctct cctggcccagGAGTT ttgtgctcagGTTAC ... ccctttacagCTCTG cactctgcagCTCTG TACGGgtatggctaa CCTAGgtaccgccag ttatctccagAGCTT ccatctccagAACTT CCTCGgtcagtgctg CCTCGgtcagtgctg tccattgtagGTGGC tctaacctagGTGGC CGAACgtaagtagag CGAATgtaagtggga ttccatacagCTCTC...
- 10
- 434
- 0
Assessment of the Nigerian poultry market chain to improve biosecurity docx
Ngày tải lên :
23/03/2014, 21:20
... Mr MAIKAITA Ango Mr YAHAYA Aliyu Mr LADAN Yakubu Mr ABBA Isa Permanent Secretary ADVS, Katsina State ADVS Disease Control (Federal Epidemiology Officer) AICP Desk Officer 45 Assessment of the ... training of operators The only formal exception to this is the fee that traders have to pay to the owner of the land on which the market is held Operators generally pay this fee on the day of market ... Even the metallic cages, which are most often home-made, have not been constructed in such a way as to allow easy cleaning From their appearance, the cages not appear to be cleaned on a daily basis,...
- 65
- 485
- 0