a portion of the script pane shows just the onrelease handler for the button called transformbutton the four parameters of the settransform method are defined as properties of the mysoundtransform object

Báo cáo khoa học: Intrinsic local disorder and a network of charge–charge interactions are key to actinoporin membrane disruption and cytotoxicity ppt

Báo cáo khoa học: Intrinsic local disorder and a network of charge–charge interactions are key to actinoporin membrane disruption and cytotoxicity ppt

Ngày tải lên : 14/03/2014, 23:20
... fitted by a monomer M dimer equilibrium The apparent molecular masses are 29 600 Da for the StnII-R29Q variant and 24 880 Da for the StnII-Y111N variant These data clearly indicate that under ... loops of the structure (Fig 5) Mutation of this arginine residue by the shorter and neutral glutamine prevents the formation of those contacts and the loops are far apart in the R29Q mutant As a ... [24] on the bases of the published assignments [22,23] The structure calculation of the StnII-R29Q and StnII-Y111N variants was performed with cyana [25] using the automatic NOE assignment facility...
  • 10
  • 375
  • 0
Báo cáo khoa học: "A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context" pptx

Báo cáo khoa học: "A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context" pptx

Ngày tải lên : 23/03/2014, 19:20
... kanji katakana katakana-kanji kanji-hiragana hiragana kanji-katakana kat akana-symbol-katakana number kanji-hiragana-kanji alphabet kanji-hir agana-kanji-hir agana hiragana-kanji percent 45.1% 11.4% ... speech Table shows examples of common charto Chinese characters Hiragana and katakana are acter bigrams for each part of speech in the infresyllabaries: The former is used primarily for grammatical ... to estimate the character bigram probabilities that are classified by word type and part of speech Basically, they are estimated from the relative frequency of the character bigrams for each word...
  • 8
  • 397
  • 0
A Development of Novel Integral Method for Prediction of Distorted Inlet Flow Propagation_2 docx

A Development of Novel Integral Method for Prediction of Distorted Inlet Flow Propagation_2 docx

Ngày tải lên : 21/06/2014, 21:20
... ratio and the static pressure rise of compressor are investigated to study the effects of inlet parameters on the compressor performance and characteristics Figure 4.16 indicates that a smaller inlet ... decrease with the decreasing of inlet distortion level With the increase of inlet flow angle, the peak point of outlet size of distorted region will move forward along α ( ) axes (Figure 4.12 and ... angle before about θ = 25° , and then will increase with the increasing of incident angle Therefore, the results are presented in two figures: Fig 4.6 and Fig 4.8 90 Chapter A Development of Novel...
  • 10
  • 240
  • 0
Báo cáo toán học: "A Hybrid of Darboux’s Method and Singularity Analysis in Combinatorial Asymptotics" potx

Báo cáo toán học: "A Hybrid of Darboux’s Method and Singularity Analysis in Combinatorial Asymptotics" potx

Ngày tải lên : 07/08/2014, 13:21
... terms are available, given the nonconstructive character of classical Tauberian theory We state: Proposition The probability that a random permutation of size n has a square-root admits a full asymptotic ... converges at least as fast as (1 + −2 ) It is seen next that singularities are at roots of unity, and the radial expansions can be computed in the usual way from the polylogarithmic expansion We can ... (z), ζ, t) The interest of radial expansions is to a large extent a computational one, as these are often accessible via common methods of asymptotic analysis while various series rearrangements...
  • 35
  • 321
  • 0
By the Light of the SoulMary Eleanor Wilkins-Freeman..By the Light of the Soul A Novel By Mary E. Wilkins Freeman Author of “The Debtor” “The Portion of Labor” “Jerome” “A New England Nun” Etc. etc.1907To Harriet and Carolyn Alden..By the Light o pptx

By the Light of the SoulMary Eleanor Wilkins-Freeman..By the Light of the Soul A Novel By Mary E. Wilkins Freeman Author of “The Debtor” “The Portion of Labor” “Jerome” “A New England Nun” Etc. etc.1907To Harriet and Carolyn Alden..By the Light o pptx

Ngày tải lên : 16/03/2014, 18:20
... far It was a quite new Queen Anne cottage of the better class, situated in a small lot of land, and with other houses very near on either side There was a great clump of hydrangeas on the small ... his pajamas, and approach the bed “What on earth is the matter?” he said He also laid hands on Maria, and, at his touch, she became able to move “What on earth is the matter?” he asked again “She ... it?” Aunt Maria called out, sharply Maria was afraid that her father would hear “It’s only me, Aunt Maria,” she replied Then she also gave a little sob 45 By the Light of the Soul “What’s the matter?”...
  • 488
  • 398
  • 0
A survey of technology thinkers and stakeholders shows they believe the internet will continue to spread in a “flattening” and improving world. There are many, though, who think major problems will accompany technology advances by 2020 doc

A survey of technology thinkers and stakeholders shows they believe the internet will continue to spread in a “flattening” and improving world. There are many, though, who think major problems will accompany technology advances by 2020 doc

Ngày tải lên : 29/03/2014, 19:20
... predictions are available in a searchable database online at the site Imagining the Internet: A History and Forecast and they are also the basis for a book by Anderson titled Imagining the Internet: ... policy advocate, agreed that the issue of interface construction plays a role “English has already become the mandated standard language … most keyboards around the world are the ASCII character ... assumptions about the back sides of mountains in Afghanistan and the behavior of entrepreneurs in Africa.” Adrian Schofield, head of research for ForgeAhead, an information and communications consulting...
  • 115
  • 441
  • 0
Báo cáo khoa học: "Adenocarcinoma of the third portion of the duodenum in a man with CREST syndrome" pot

Báo cáo khoa học: "Adenocarcinoma of the third portion of the duodenum in a man with CREST syndrome" pot

Ngày tải lên : 09/08/2014, 07:21
... depicting a mass Computed tomography of the abdomen depicting a mass (arrows) in the duodenum was carried out Histological examination revealed a lowgrade duodenal adenocarcinoma of maximal diameter ... has been stated that primary duodenal adenocarcinoma is one of the main causes of death in patients with FAP [11] A case of an early duodenal adenocarcinoma from a Brunner's gland has been reported ... 50:636-641 Akino K, Kondo Y, Ueno A, Yamazaki K, Hosokawa M, Shimozi H, Adachi T, Honda S, Ichiyanagi S, Akahonai Y, Fujisawa Y, Takahashi H, Arimura Y, Endo T, Imai K: Carcinoma of duodenum arising...
  • 4
  • 202
  • 0
Báo cáo y học: "The triple combination of tenofovir, emtricitabine and efavirenz shows synergistic anti-HIV-1 activity in vitro: a mechanism of action study" pdf

Báo cáo y học: "The triple combination of tenofovir, emtricitabine and efavirenz shows synergistic anti-HIV-1 activity in vitro: a mechanism of action study" pdf

Ngày tải lên : 12/08/2014, 23:21
... (5'-GTCCCTGTTCGGGCGCCAC), D25 (5'-CTGAGACAACATCTGCTGAGGTAGG), and D26 (5'-CTGAGACAACATCTG CTGAGGTA GGA), and templates D3 6A (3'-CGAAAGTCCAGGGA CA AGCCCGCGGTG TGTATCTCT), D36C (3'-CGAAAGTC- Page of 16 (page number ... biochemical assays FM and DG carried out the cell-based drug combination assays KLW and ESS participated in the study design, data analysis, and manuscript preparation KBE and MDM participated in the ... NRTI analogs [25] There are many methods available to analyze the effect of drug combinations [35-37] Synergy and antagonism are commonly defined as a greater or lesser pharmacological effect than...
  • 16
  • 377
  • 0
Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx

Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx

Ngày tải lên : 13/08/2014, 09:20
... responsible for the pattern observed in the dendrogram, a two-way ANOVA was fit to each probeset using activation and knockdown state as explanatory variables A linear contrast analysis was then performed ... β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, ... required for the appropriate expression of a sizable portion of mRNAs regulated by PMA In our transcriptional profiling data, PMA treatment and cyclin T1 knock-down are two major variables in the RNA...
  • 16
  • 178
  • 0
A STUDY ON THE STRUCTURAL FEATUES OF ENGLISH NEWS STORY.DOC

A STUDY ON THE STRUCTURAL FEATUES OF ENGLISH NEWS STORY.DOC

Ngày tải lên : 02/09/2012, 11:12
... Newspapers impart news by the language And it is newspaper that is the most typical mean of indicating language as well as indicating any change of language and life Because language is a mean of ... of a social group The system of language is a part of shared cultural knowledge of social groups, and ways of communicating are an important part of the observable behavior of people in social ... details for the second paragraph and save less important details for succeeding paragraph The least important part comes at the end and the story just stops abruptly This way is called inverted-pyramid...
  • 62
  • 1.1K
  • 5
Howto Books The A-Z Of Correct English

Howto Books The A-Z Of Correct English

Ngày tải lên : 05/10/2012, 09:46
... (iii) CAPPUCCINO cast or caste? Use CAST for a group of actors in a play and for a plaster CAST and a CAST in an eye Use CASTE when referring to a social group in Hindu society caster or castor? ... athelete) athletics (not atheletics) 22 ASTHMA ASTHMA AXIS attached, attaching, attachment (not -tch) audible (not -able) audience (not -ance) aural or oral? AURAL refers to the ears and hearing ... exemplar sentences as a guide: BACHELOR I have a BATH every morning (= I have a wash in the bath) I BATH the baby every day (= wash in a bath) I have had a new BATH fitted We BATHE every day (=...
  • 203
  • 785
  • 6
Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Intelligent Software Agents on the Internet: an inventory of currently offered functionality in the information society & a prediction of (near-)future developments

Ngày tải lên : 08/10/2012, 15:22
... of information that have changed rapidly in the last few years are the amount that it is available in, the number of sources and the ease with which it can be obtained Expectations are that these ... Information access and management is an area of great activity, given the rise in popularity of the Internet and the explosion of data available to users It is the application area that this thesis ... user's activities and learns which tasks are repeated again and again It then offers to perform those repetitive tasks for the user automatically Open Sesame! can also automate crucial maintenance...
  • 100
  • 811
  • 3
Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"

Báo cáo y học: "Spontaneous Hemoperitoneum Caused By a Diverticulum of the Sigmoid Colon"

Ngày tải lên : 25/10/2012, 10:51
... which makes its wall weak, as compared to the small intestine that is formed of the inner circular and outer longitudinal muscle layers The vasa recta, which supply the mucosa and submucosa of the ... preparation The bleeding was controlled by #3-0 Vycryl intracorporeal suture, and the invagination of the diverticulum was performed laparoscopically The recovery was uneventful, and the patient ... addition, the remaining colon wall was normal, but the bowel preparation was poor The invagination of diverticulum has an advantage over diverticulectomy in that it minimizes bowel leakage [15]...
  • 3
  • 531
  • 0
Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"

Báo cáo y học: "Mirror-Image Arachnoid Cysts in a Pair of Monozygotic Twins: A Case Report and Review of the Literature"

Ngày tải lên : 25/10/2012, 11:00
... our case, the lack of a previous history of trauma, infection and head surgery leads us to believe that the AC was due to a congenital anomaly Mirror images in MZ and AC are not relatively rare ... and follow-up Therefore, a large percentage of patients with AC are probably undiscovered Mirror images, on the other hand, are present in approximately 25% of MZ Therefore, we suggest that the ... temporal fossa AC Helland et al 20 found the Na+–K+–2Cl− cotransporter NKCC1 gene was escalated in AC and NKCC1 was present in the AC wall These finding indicated NKCC1 gene might play an important...
  • 4
  • 652
  • 0
Testing a model of customer-based brand equity in the Vietnamese banking servic

Testing a model of customer-based brand equity in the Vietnamese banking servic

Ngày tải lên : 06/11/2012, 15:52
... perceived quality, 4) brand associations (which are driven by brand 11 identity: the brand as a product, the brand as an organization, the brand as a person and the band as a symbol) The fifth ... concepts and has been an area of interest for marketing academics and practitioners as well There are a numbers of models of brand equity in common marketing settings (Farquhar,1989; David A Aaker, 1991; ... reasonable price 3.4.2 Scale to measure rational and emotional associations This study adapts the scale developed by Martensen and Grønholdt (2004) to measure the rational and emotional associations...
  • 81
  • 562
  • 1
A study on the translation of economic terminology

A study on the translation of economic terminology

Ngày tải lên : 07/11/2012, 14:12
... terminology as mentioned in 1.2 As the terms of each group share the same grammatical features that inevitably lead to the similar ways of the translation we have found out the appropriate strategies ... based on the analysis of grammatical and semantic features of the terms in this field The study has also attempted to indicate the most popular ways of the translation of the terms investigated ... Protection of the textbook The major aspects of the investigation are the classification, grammatical structures and the English-Vietnamese translation of economic terms in this part Aims of the Study...
  • 40
  • 2.1K
  • 24
A study on the techniques for the improvement to the teaching of oral skills in light of communicative english language teaching for junior high school teachers in quang ngai province part 1

A study on the techniques for the improvement to the teaching of oral skills in light of communicative english language teaching for junior high school teachers in quang ngai province part 1

Ngày tải lên : 07/11/2012, 14:41
... • The Audio-Lingual Method The Audio-Lingual Method was a largely American invention in the 1960s It was based on the idea of Behaviorism, which considered language as simply as a form of behavior, ... it matter? • What should the teacher about it? IMPORTANT POINTS: • Mistakes are not “bad” • They are natural and unavoidable part of learning a language • They are useful They show the teacher ... this method that the language laboratory became so popular 5 • The Functional-Notional Approach In the 1970s teachers of the Functional-Notional Approach stopped teaching grammar and started teaching...
  • 48
  • 1.3K
  • 7