a participatory method for designing sustainable health it
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx
Ngày tải lên :
28/03/2014, 09:20
... Global Health repair in West Africa and making newborn health a priority in Latin America and the Caribbean Finally, the Bureau for Global Health gave technical assistance and administered a grants ... Survival and Maternal Health account in fiscal years 2004 and 2005 helped fund wide-ranging efforts to lower maternal and child mortality in Africa, Asia and the Near East, and Latin America and ... countries in Africa, Asia and the Near East, and Latin America and the Caribbean and to the Bureau for Global Health In allocating the funds, the agency considered various factors in its annual budgeting...
- 64
- 379
- 0
báo cáo khoa học: "The behaviour change wheel: A new method for characterising and designing behaviour change interventions" pps
Ngày tải lên :
10/08/2014, 10:23
... system For example, opportunity can influence motivation as can capability; enacting a behaviour can alter capability, motivation, and opportunity Page of 11 Figure The COM-B system - a framework for ... place for a specified behavioural target to be achieved?’ The ‘intervention mapping’ approach is based on an epidemiological analysis of co-variation within the behavioural domain and starts with ... educational materials) and organisational interventions (local consensus processes); ‘financial’ includes individual and organisational incentives and environmental restructuring (changing the available...
- 12
- 328
- 0
a rapid method for estiminating of noise expouse workplace
Ngày tải lên :
05/09/2013, 13:23
... sensitivity and specificity are usually inversely related (15) Any other studies had similar results for specificity to obtain a reliable test for screening Sadri and Mahjub gave a low sensitivity ... Less than years Quality of maintenance of equipments Suitable Little suitable Unsuitable Rotation and duration of noise produce noise sources All of shift Half of a shift Less than a half shift ... Checklist and SPAN in Veterans Affairs primary care settings (16) In this study, the positive predictive value was 25 Golmohammadi R et al: A Rapid Method for 62.5% and negative predictive value as...
- 7
- 418
- 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
Ngày tải lên :
18/02/2014, 13:20
... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart ... Chemicals, Toyko, Japan) using a Varian Pro Star 410 autosampler (Varian Inc., Palo Alto, CA, USA), and eluted at 1.5 mLÆmin)1 with a 14–49% acetonitrile gradient using a Varian Pro Star HPLC...
- 16
- 691
- 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
Ngày tải lên :
18/02/2014, 17:20
... 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were cloned into the EcoRV site ... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...
- 11
- 873
- 0
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx
Ngày tải lên :
08/03/2014, 04:22
... Annual Meeting of the Association for Computational Linguistics, pages 188-195 Ferreira da Silva, J and G Pereira Lopes (1999) A local maxima method and a fair dispersion normalization for extracting ... adopting a nonparametric measure of strength of association Evaluation indicates that this method may outperform standard lexical association measures, including mutual information, chi-squared, ... stronger than their association for other phrases That is, to the extent that phrasal terms follow the regular patterns of the language, a phrase might have a relatively low conditional probability...
- 9
- 507
- 1
A Resource List for Adolescent Reproductive Health Programming in Conflict Settings pot
Ngày tải lên :
22/03/2014, 12:20
... on Young Adults and CARE InternationalZambia, 1999, by Meera Kaul Shah with Rose Zambezi and Mary Siamsiku, PDF, 12 pages "Listening to Young Voices: Facilitating Participatory Appraisals on Reproductive ... Promotion Programs and Social Networks in Ghana: Methods for Monitoring and Evaluating AIDS Prevention and Reproductive Health Programs among Adolescents and Young Adults" Available hardcopy only, ... examples (Costa Rica, Malaysia, Mexico, Philippines, South Africa, Tanzania, Thailand and Tunisia) of ongoing adolescent health and development programs to illustrate how these programs are learning...
- 16
- 314
- 0
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
Ngày tải lên :
23/03/2014, 06:20
... concentration, and lactate concentration, within the following physiologically feasible ranges: k kATPase k0 ATPase ATPase (small variation of the energetic load) k kATPase k0 ATPase ATPase (large variation ... sufciently broad concentration range In some cases, the derivation of a detailed rate law can be facilitated by searching enzyme databases [33,34] for rate laws already established for the same enzyme ... measure to each possible saturation parameter, evaluating its linkage with changes in the largest eigenvalue of the Jacobian matrix Fixing a reasonable threshold value for the statistical measure...
- 15
- 456
- 0
Synchronizing Gender Strategies: A Cooperative Model for Improving Reproductive Health and Transforming Gender Relations pot
Ngày tải lên :
28/03/2014, 14:20
... Greene and Barker, “Masculinity and Its Public Health Implications for Sexual and Reproductive Health and HIV Prevention.” Arachu Castro and Merrill Singer, ed., Unhealthy Health Policy: A Critical ... Senegal and nine other African countries (Burkina Faso, Djibouti, The Gambia, Guinea, Guinea Bissau, Mali, Mauritania, Somalia, and Sudan) have followed suit, and have committed to ending FGC and ... norms and imbalance of power as a means of reaching health as well as genderequity objectives Gender-transformative approaches encourage critical awareness among men and women of gender roles and...
- 40
- 430
- 0
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
Ngày tải lên :
30/03/2014, 21:20
... Contextual word similarity and estimation from sparse data Computer, Speech and Language, 9:123–152 Keiji Shinzato, Tomohide Shibata, Daisuke Kawahara, Chikara Hashimoto, and Sadao Kurohashi 2008 ... 10, and 20 are shown for each similarity measure As for BCb and BCa , the results for the tuned and several other values for α are shown Figure shows the parameter tuning for BCb with MAP as the ... similarities using a large amount of Web data in Japanese and show that the proposed measure gives better word similarities than a non-Bayesian Bhattacharyya coefficient or other well-known similarity...
- 10
- 472
- 0
Báo cáo khoa học: "A Unification Method for Disjunctive Feature Descriptions" pot
Ngày tải lên :
31/03/2014, 17:20
... of a formula contain information that is more definite than the information contained in disjunctions Thus a formula can be regarded as having a definite part, containing only unconditional conjuncts, ... editors, Natural Language Parsing Cambridge University Press, Cambridge, England, 1985 [8] Perelra, F C N and D H D Warren Definite clause grammars for language analysis - a survey of the formalism ... experimental parser for a grammar containing several hundred disjunctions in its description Therefore, we expect that it can be used as the basis for language processing systems requiring large grammatical...
- 8
- 361
- 0
a novel method for the synthesis of titania nanotubes using
Ngày tải lên :
05/05/2014, 15:26
... nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere (Fig 12) Titania nanotubes prepared by the sonoelectrochemical method ... gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of the titania S.K Mohapatra et al / Journal of Catalysis 246 (2007) 362–369 nanotubes, ... in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated N2 -UAT and O2 -UAT The TiO2 nanotubes...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
Ngày tải lên :
06/05/2014, 08:55
... high surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, such as of edge and corner ... decomposition applications of Co-Precipitation in the absence and presence nanosized metal oxides such as AP-MgO, AP- of Polyvinylpyrrolidone (PVP) as a capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO ... particle size, a polymer contaminates In recent years, nanocrystalline is often used, either natural or synthetic, with inorganic metal oxides as solid reactive some affinity for metals catalyst sorbents...
- 12
- 705
- 0
Báo cáo hóa học: "One Step Nucleic Acid Amplification (OSNA) - a new method for lymph node staging in colorectal carcinomas" docx
Ngày tải lên :
18/06/2014, 16:20
... amplification of CEA were: 5’AGACAATCACAGTCTCTGCGGA-3’ (forward) and 5’- ATCCTTGTCCTCCACGGGTT-3’ (reverse) The cut-off was set at cycle time = 29.6 for CK19, 28.5 for CEA, and 30.0 for beta-actin ... OSNA (CK19 mRNA as a marker) and intensive histological methods (H&E and CK19 IHC on levels for each of LN slices) RNA quality was assured by OSNA performed for beta-actin 139 samples gave a negative ... polymerase chain reaction as part of discordant case investigation (DCI) DCI was performed after the original analysis OSNA runs were repeated from discordant sample homogenates and afterwards RNA...
- 6
- 535
- 0
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx
Ngày tải lên :
18/06/2014, 18:20
... TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG ... GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ORF located in ... genome amplification and fragment amplification Primers WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC...
- 7
- 404
- 0
Báo cáo sinh học: " A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" potx
Ngày tải lên :
19/06/2014, 08:20
... including guanidine thiocyanate denaturation plus phenol/chloroform extraction, the ZR Viral RNA Kit (ZYMO Research) and the QIAamp Viral RNA Mini Kit (Qiagen) The QIAamp Viral RNA Mini Kit (Qiagen) ... Maureen Donlin, Brandon Steel, and Nathan Cannon for technical assistance We thank Adrian Di Bisceglie and Xiaofeng Fan for helpful discussions References Additional File Primers for amplification ... hepatitis C viruses from a single patient Gene 1992, 117:229-232 Higashi Y, Kakumu S, Yoshioka K, Wakita T, Mizokami M, Ohba K, Ito Y, Ishikawa T, Takayanagi M, Nagai Y: Dynamics of genome change...
- 9
- 444
- 0
Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx
Ngày tải lên :
19/06/2014, 08:20
... Pain and self-reported characteristics Self-rated pain was assessed as pain at the moment and measured within a week before the day of testing on a blank 100 mm visual analogue scale (VAS), on ... authors would like to thank Nisse Larson for excellent engineering assistance, Maria Frykman for valuable assistance during data collection and Margaretha Marklund for graphical work References Competing ... physical functioning, vitality and social functioning Functional improvement was revealed as decreased disability measured with DASH Also, fear of movement, measured with TSK, decreased significantly...
- 10
- 712
- 0
báo cáo hóa học: "A binary method for simple and accurate two-dimensional cursor control from EEG with minimal subject training" potx
Ngày tải lên :
19/06/2014, 08:20
... one male, with ages ranging from 24–55 years Subject A was female, age 53 years Subject B was female, age 55 years Subject C was female, age 24 years Subject D was male, age 32 years We also carried ... C and D classification is perfect the same channel/bin as with real movement for the sake of parsimony As described above, because no EMG signal was available with which to compare classification, ... the paradigm within OB's software system for EEG data acquisition and processing TAK also assisted with data collection, performed the data analysis, and drafted and revised the manuscript OB...
- 16
- 489
- 0
Báo cáo hóa học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primers" potx
Ngày tải lên :
20/06/2014, 01:20
... TTTCACCTCTGCCTAATCATCTC TTT ACCTCTGCCTAATCATCTC TCTTGTTCCCAAGAATATGGTG GCGTCGCAGAAGATCTCAAT TTGAGAGAAGTCCACCACGAG CTGCTGGTGGCTCCAGTT GCCTTGTAAGTTGGCGAGAA GTATTGGGGGCCAAGTCTGT GTATTGGGGGCCAAATCTGT AAAAAGTTGCATGGTGCTG ... GCCGCGTCGCAGAAGATCTCAATCTC GGGTCACCATATTCTTGGGAACAAGA CCTGCTGGTGGCTCCAGTTC TCCTAGGACCCCTGCTCGTGTT ACTTCTCTCAATTTTCTAGGGGG TATATGGATGATGTGGTATTGGGGGCCAA TTCTCGCCAACTTACAAGGCCTTTCT CACCAGCACCATGCAACTTTTT ORF located in ... genome amplification and fragment amplification Primers WA-L WA-R FA1-L FA1-L' FA1-R FA2-L FA2-R FA3-L FA3-R FA4-L FA4-L' FA4-R Sequence ACTGTTCAAGCCTCCAAGCTGTGC AGCAAAAAGTTGCATGGTGCTGGT TTTCACCTCTGCCTAATCATCTC...
- 7
- 566
- 0