a one cp csa for pcp undertaken jointly by public sector organisations in member states and associated countries

business model you a one-page method for reinventing your career

business model you a one-page method for reinventing your career

Ngày tải lên : 29/05/2014, 14:38
... pictures appear in the front pages, and their names appear below.1 Adie Shariff Afroz Ali AJ Shah Alan Scott Alan Smith Alejandro Lembo Alessandro De Sanctis Alexander Osterwalder Alfredo Osorio Asenjo ... Ali Heathfield Allan Moura Lima Allen Miner Amber Lewis Andi Roberts Andre Malzoni dos Santos Dias Andrew E Nixon Andrew Warner Anne McCrossan Annemarie Ehren Annette Mason Ant Clay Anthony Caldwell ... Michael Weiss Mikael Fuhr Mike Lachapelle Miki Imazu Mikko Mannila Mohamad Khawaja Natasja la Lau Nathalie Ménard Nathan Robert Mol Nathaniel Spohn Nei Grando Niall Daly Nick Niemann Nicolas De...
  • 257
  • 411
  • 0
Báo cáo hóa học: " Research Article A Low-Complexity Algorithm for Static Background Estimation from Cluttered Image Sequences in Surveillance Contexts" doc

Báo cáo hóa học: " Research Article A Low-Complexity Algorithm for Static Background Estimation from Cluttered Image Sequences in Surveillance Contexts" doc

Ngày tải lên : 21/06/2014, 08:20
... the background is static and is revealed at some point in the training sequence for a short interval and (ii) the camera is stationary The background is estimated by recasting it as a labelling ... (http://www.multitel.be/∼va/candela/), and 10 unscripted sequences obtained from a railway station in Brisbane The CAVIAR and and CANDELA sequences were chosen based on four criteria: (i) a minimum duration of 700 frames, ... Typically, after initialising all the empty nodes, an accurate estimate of the background is obtained Nonetheless, in certain circumstances an incorrect label assignment at a node may cause an...
  • 14
  • 657
  • 0
báo cáo khoa học: " IMPLEmenting a clinical practice guideline for acute low back pain evidence-based manageMENT in general practice (IMPLEMENT): Cluster randomised controlled trial study protocol" pps

báo cáo khoa học: " IMPLEmenting a clinical practice guideline for acute low back pain evidence-based manageMENT in general practice (IMPLEMENT): Cluster randomised controlled trial study protocol" pps

Ngày tải lên : 11/08/2014, 05:22
... printed educational material, dissemination and, audit and feedback The trials had varying success in changing certain behaviours of the included practitioners and provide some information about ... CPG's key messages, namely that diagnostic x-rays are rarely necessary in the management of acute LBP and that advising patients to remain active reduces pain and disability The intervention will ... check a sample of data abstracted from patient medical records Table 2: Behavioural constructs Domains Explanation Domain measured for behaviour X-ray1 Behavioural intention3 Generalised Performance...
  • 12
  • 217
  • 0
Báo cáo y học: " Low autocrine interferon beta production as a gene therapy approach for AIDS: Infusion of interferon beta-engineered lymphocytes in macaques chronically infected with SIVmac251" pot

Báo cáo y học: " Low autocrine interferon beta production as a gene therapy approach for AIDS: Infusion of interferon beta-engineered lymphocytes in macaques chronically infected with SIVmac251" pot

Ngày tải lên : 13/08/2014, 13:20
... 5': CCGTCAGGATCAGATATTGCAGGAA and 2042C 5': CACTAGCTTGCAATCTGGGTT), as previously described [26] Statistical analysis Statistical significance was determined by paired or unpaired non parametric ... lose financially from the publication of this paper in the past five years The authors never any stocks or shares in an organization that may in any way gain or lose financially from the publication ... Transduction efficacy was estimated with transduced PBLs maintained in culture for days Evaluation of the transduction rate DNA was extracted from macaque PBMCs and the amount used for each sample...
  • 11
  • 256
  • 0
development of a direct test method for dynamically assessing the liquefaction resistance of soils in situ

development of a direct test method for dynamically assessing the liquefaction resistance of soils in situ

Ngày tải lên : 14/11/2014, 13:09
... Lee, Asli Kurtulus and Yin-Cheng Lin for sharing an office and advice, to Wayne Fontenot, Max Trevino and Gonzalo Zapata for helping my to blow off steam and refine my ping-pong skills during ... lunch, and to Teresa Tice-Boggs, Chris Trevino and Alicia Zapata for their administrative support I am most grateful to my dear wife, and eternal companion, Audrey Her strength and support in my ... 8-13 Measure G/Gmax values and predicted G/Gmax values obtained from taking into account the combined effects of modulus degradation and nonlinearity after 20, 50 and 100 cycles of loading during...
  • 542
  • 309
  • 0
Implementation of a drug discovery tool for the evaluation of anti fibrotic compounds application in fibrovascular disorders

Implementation of a drug discovery tool for the evaluation of anti fibrotic compounds application in fibrovascular disorders

Ngày tải lên : 09/10/2015, 11:07
... Shanshan and the attachment students: Shriju Joshi, Amelia Ann Michael, Natasha Lee, Brenda Lim, Rosanna Chau, Srividia Sundararaman, Zhang Lei) and the Skin Cells Research Group members (Anandaroop ... manually can be laborious and time consuming Assays that measure metabolic activity Metabolic activity can be an indication of cell viability There are several metabolic based assays available in ... culture was trypsinized and replated at a ratio of 1:5 Trypsinization was performed by incubating the cells in a minimal amount (1ml for T-75 flask) of Trypsin-EDTA (1x) for at 37ºC The trypsin was...
  • 74
  • 224
  • 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Ngày tải lên : 14/02/2014, 21:20
... because that race was rowed so many years ago that in discussing it we are treating rather of obtained results than of estimated probabilities; we are in fact dealing to a greater extent than ... contests are not allowed to pass unnoticed ; newspapers, periodicals, almanacs and magazines vie with each other in chronicling the fullest particulars regarding victors and vanquished, and there are ... " About a week before the race I felt a pain in my left arm as if I had got rheumatism, and it became rather stiff till after the race, and then severe inflammation set in, in the elbow-joint,...
  • 419
  • 541
  • 0
báo cáo khoa học: " Circumcision for prevention against HIV: marked seasonal variation in demand and potential public sector readiness in Soweto, South Africa" pdf

báo cáo khoa học: " Circumcision for prevention against HIV: marked seasonal variation in demand and potential public sector readiness in Soweto, South Africa" pdf

Ngày tải lên : 11/08/2014, 05:22
... Soweto in a traditional setting are not available, and these data will be an important component for developing programs and plans for innovative delivery solutions Moreover, the concerns raised about ... Bertran A: Acceptability of male circumcision as a tool for preventing HIV infection in a highly infected community in South Africa Aids 2003, 17(1):89-95 Rain-Taljaard RC, Lagarde E, Taljaard ... have a public health impact Certainly, just the additional numbers that may be referred by large HIV prevention clinical trials would be equal to the total annual caseload The striking variation...
  • 3
  • 227
  • 0
báo cáo khoa học: " Peer chart audits: A tool to meet Accreditation Council on Graduate Medical Education (ACGME) competency in practicebased learning and improvement" docx

báo cáo khoa học: " Peer chart audits: A tool to meet Accreditation Council on Graduate Medical Education (ACGME) competency in practicebased learning and improvement" docx

Ngày tải lên : 11/08/2014, 05:22
... reviewed manually to ascertain that no patient's chart was used more than once per audit Audit one was performed in June 2003 Residents were allowed to abstract information dating back for one year ... monofilament or fork test), vascular (pedal pulses), and skin findings [13] Statistical Analyses Standard descriptive statistics were used and data were analyzed using SPSS® (Chicago, IL) Audits ... design and coordination and helped to perform the statistical analysis CE participated in the design and coordination of the study, helped to draft the manuscript and performed the statistical analysis...
  • 5
  • 210
  • 0
Báo cáo khoa học: "Case mix, outcome and length of stay for admissions to adult, general critical care units in England, Wales and Northern Ireland: the Intensive" pptx

Báo cáo khoa học: "Case mix, outcome and length of stay for admissions to adult, general critical care units in England, Wales and Northern Ireland: the Intensive" pptx

Ngày tải lên : 12/08/2014, 20:20
... of Clinical Databases (www.docdat.org), criteria on coverage and accuracy now exist for determining the quality of clinical databases • The Case Mix Programme Database performs well against the ... recommended that all units should take part [7,8] Data collection, validation and reporting CMP data are recorded prospectively and abstracted onto standard forms by trained data collectors according to ... data The CMP uses data collection training, the data collection manual and a precise dataset specification to minimise this variability Training in data definitions has been shown effective in...
  • 13
  • 234
  • 0
conceptual framework for general purpose financial reporting by public sector entities

conceptual framework for general purpose financial reporting by public sector entities

Ngày tải lên : 04/11/2014, 22:20
... demasiada frecuencia o de manera inoportuna página Reglas de la ICC para Combatir la Corrupción Artículo Pagos para Facilitación Los pagos para facilitación son pagos pequeños, inapropiados e informarles ... que se hacen a un funcionario de bajo nivel para asegurar o agilizar la realización de una acción rutinaria o necesaria, a la cual el pagador tiene legalmente derecho Los pagos para facilitación ... reportes levantados de buena fe deben de ser investigados.; n) actuar en violaciones reportadas o detectadas, tomando la acción correctiva y las medidas disciplinarias apropiadas, y analizar la posibilidad...
  • 18
  • 206
  • 0
Which interest rate scenario is the worst one for a bank? Evidence from a tracking bank approach for German savings and cooperative banks potx

Which interest rate scenario is the worst one for a bank? Evidence from a tracking bank approach for German savings and cooperative banks potx

Ngày tải lên : 22/03/2014, 23:20
... 34 2007 Factor-MIDAS for now- and forecasting with ragged-edge data: a model comparison for German GDP Massimiliano Marcellino Christian Schumacher 35 2007 Monetary policy and core inflation Michele ... 10 For more information on the Bundesbank's banking data see Memmel and Stein (2008) talks with practitioners of the savings banks and cooperative banks sector, we know 11 From that the average ... quality of banking and regional growth Hasan, Koetter, Wedow 11 2007 Welfare effects of financial integration Fecht, Grüner, Hartmann 12 2007 The marketability of bank assets and managerial Falko...
  • 40
  • 468
  • 0
comptia a+ certification all-in-one desk reference for dummies

comptia a+ certification all-in-one desk reference for dummies

Ngày tải lên : 25/03/2014, 15:21
... have done an amazing job again! I also want to thank Dan Lachance, who is always around for a little bit of geek talk! Thanks to Riley, Haley, and Sara for helping me take some of the photos for ... exam and Table 1-1 contains the number of questions and passing score for each exam CompTIA is releasing the exams as linear format exams or standard timed exams which are taken on a computer After ... http://www.comptia.org/certification/ general_information/candidate_agreement.aspx Take and pass the CompTIA certification exam(s) For more information about CompTIA’s certifications, such as its industry acceptance,...
  • 1.2K
  • 423
  • 1
Báo cáo hóa học: " Research Article Impact of LQI-Based Routing Metrics on the Performance of a One-to-One Routing Protocol for IEEE 802.15.4 Multihop Networks" docx

Báo cáo hóa học: " Research Article Impact of LQI-Based Routing Metrics on the Performance of a One-to-One Routing Protocol for IEEE 802.15.4 Multihop Networks" docx

Ngày tải lên : 21/06/2014, 11:20
... on Advanced Information Networking and Applications Workshops/Symposia (AINAW ’07), vol 1, pp 159–164, Niagara Falls, Canada, May 2007 [16] R Draves, J Padhye, and B Zill, “Routing in multi-radio, ... routes towards a destination is guaranteed by means of a destination sequence number, which is updated when new information about that destination is received When a link in an active path breaks, ... used The main drawback of an LQI-based link quality estimator is the fact that it may provide spurious link quality indications in a medium quality link If such a link appears to temporarily exhibit...
  • 20
  • 397
  • 0
báo cáo khoa học: "Successful one stage operation for a synchronous, duodenal carcinoma, colonic carcinoma and renal oncocytoma in an adult patient" pot

báo cáo khoa học: "Successful one stage operation for a synchronous, duodenal carcinoma, colonic carcinoma and renal oncocytoma in an adult patient" pot

Ngày tải lên : 09/08/2014, 02:21
... Europe and Canada was analyzed in terms of incidence of second primary cancers following a diagnosis of small intestinal malignancy This study reported a 68% overall increase in the risk of a new ... Cite this article as: Faraj et al.: Successful one stage operation for a synchronous, duodenal carcinoma, colonic carcinoma and renal oncocytoma in an adult patient World Journal of Surgical Oncology ... carcinoma of the small intestine and for colorectal, pancreatic and endometrial cancer the increased risk was mainly after early-onset small intestine cancer The authors suggest that this supports...
  • 3
  • 263
  • 0
Báo cáo khoa hoc:" CP-31398, a putative p53-stabilizing molecule tested in mammalian cells and in yeast for its effects on p53 transcriptional activity" potx

Báo cáo khoa hoc:" CP-31398, a putative p53-stabilizing molecule tested in mammalian cells and in yeast for its effects on p53 transcriptional activity" potx

Ngày tải lên : 11/08/2014, 08:20
... cellular system such as a yeast cell should be suitable to assess DNA-binding and transcriptional activation activity regardless of posttranslational modifications and other influences that are inevitable ... β-galactosidase assay to measure activation of the lacZ reporter gene Wild type p53 and the indicated point mutant variants were transformed into the p53 responsive reporter strain and β-galactosidase ... Lumat LB 9507) β-galactosidase assays were performed according to standard methods using 50 µl of the extract and luciferase units were normalized according to β-galactosidase values All measurements...
  • 9
  • 485
  • 0
Báo cáo y học: "Dialectical Behavioral Therapy for Adolescents (DBT-A): a clinical Trial for Patients with suicidal and self-injurious Behavior and Borderline Symptoms with a one-year Follow-up" pot

Báo cáo y học: "Dialectical Behavioral Therapy for Adolescents (DBT-A): a clinical Trial for Patients with suicidal and self-injurious Behavior and Borderline Symptoms with a one-year Follow-up" pot

Ngày tải lên : 13/08/2014, 18:21
... behavioral treatment, that includes concurrent individual therapy once a week, family therapy as needed and a multifamily skills training group in an outpatient setting An open clinical trial by ... clinical trial has been performed by Goldstein et al [9] DBT -A has been adapted and modified by Fleischhaker and colleagues for use in Germany [10] The published treatment manual was used in a pilot ... of adolescents satisfying this criterion one year after therapy (t3) Frantic efforts to avoid real or imagined abandonment A pattern of unstable and intense interpersonal relationships characterized...
  • 10
  • 449
  • 0
A Fast File System for UNIX

A Fast File System for UNIX

Ngày tải lên : 12/09/2012, 14:16
... contains information describing ownership of the file, time stamps marking last modification and access times for the file, and an array of indices that point to the data blocks for the file For ... bookkeeping information that includes a redundant copy of the super-block, space for inodes, a bit map describing available blocks in the cylinder group, and summary information describing the usage ... allocated space The problem with expanding a file one fragment at a a time is that data may be copied many times as a fragmented block expands to a full block Fragment reallocation can be minimized...
  • 14
  • 1K
  • 0