... http://www.virologyj.com/content/5/1/135 (A) A T AA T T T AA T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI SacI T AA T C G T G G C G C C G AAG CGCCTTTTCCT original viral sequence ... CATGATCAACTGCTCTGATTAC GGGCTTCCCGTACTTTGTG TGGATTTAGCTCCCTGAATG TYLCV primers for Q-PCR (176 bp amplicon) Ty 2164+ Ty 2339- CTAAGAGCCTCTGACTTACTGC AACATTCAGGGAGCTAAATCCAG 200 nM 200 nM Actin2 ... GGTCGCTTCGACATARTCACG 200 nM 200 nM Sequencing of TYLCV cloned sequences pGreen1589 (+) pG1825(-) 579 (+) 1141 (+) 1741(+) 2321(+) CACGACGTTGTAAAACGACG CACAGGAAACAGCTATGACC GATGTTACTCGTGGATCTGG CATGATCAACTGCTCTGATTAC...
... Cancer Res 2005, 65(9):3920-3927 54 Al-Ramadi BK, Fernandez-Cabezudo MJ, El-Hasasna H, Al-Salam S, Attoub S, Xu D, Chouaib S: Attenuated Bacteria as Effectors in Cancer Immunotherapy Ann N Y Acad ... 107) and DT-EGF have reached the stage of clinical trials in patients of brain tumor and metastatic carcinomas respectively [48] Similarly a large variety of antibodies and ligands to surface antigens ... bacteria, such as Clostridia and Bifidobacterium, will be evaluated in human clinical trials in the future New strains of bacteria being investigated as anticancer agents are: Salmonella choleraesuis,...
... function, and can expand small vessels and improve permeability; C 3a, C 4a and C 5a have anaphylatoxin function, and can degranulate mast cells and basophils, release vasoactive mediators and induce ... induce inflammatory reaction; C 3a, C 5a Page of and C5b67 have chemotaxis function, and can attract inflammatory cells to concentrate and migrate toward the inflammatory region activated by the ... which may induce inflammation again, damage the lung, and finally result in fatal pneumonia and acute respiratory tract infection syndromes This indicates that influenza patients require both antiviral...
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... and an increase in tau hyperphosphorylation Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid plaques that subsequently form may ... cycle has not been Fig Potential relationship between decreased intracellular metal bio-availability and the oxidative stress, tau hyperphosphorylation and extracellular Ab accumulation characteristic...
... conducted a caspase activity assay MK-4 activated caspase assay in a dose-dependent manner (Fig 2C) By contrast, vitamin K1 did not show any effects on caspase activity and DNA fragmentation (data not ... six patients with RA and synoviocytes were maintained in separate cultures These patients had active RA as defined by the clinical criteria of the American Rheumatism Association [25] All RA patients ... isothiocyanate apoptosis kit (Takara Bio Inc., Shiga, Japan) 4592 CIA model in rats Seven-week-old female dark agouti rats were obtained from Japan SLC, Inc (Shizuoka, Japan) 0.3% Collagen type...
... Janciauskiene S, Eriksson S, Callea F, Mallya M, Zhou A, Seyama K, Hata S & Lomas DA (2004) Differential detection of PAS-positive inclusions formed by the Z, Siiyama and Mmalton variants of a1 -antitrypsin ... LM, Lacbawan F et al (1999) Familial dementia caused by polymerization of mutant neuroserpin Nature 401, 376–379 Davis RL, Shrimpton AE, Carrell RW, Lomas DA, Gerhard L, Baumann B, Lawrence DA, ... retain its inhibitory activity against the target proteinase Experimental procedures Materials Ni-NTA agarose was from Qiagen (Crawley, UK), HiTrap Q-Sepharose and Ficoll PM70 were from Amersham...
... NFκB κ MIAPaCa Figure 11 Nanocurcumin blocks activation of nuclear factor kappa B in pancreatic cancer cell lines Nanocurcumin blocks activation of nuclear factor kappa B in pancreatic cancer cell ... proliferation and antiapoptotic and metastatic gene products through suppression of IkappaBalpha kinase and Akt activation Mol Pharmacol 2006, 69:195-206 Hidaka H, Ishiko T, Furuhashi T, Kamohara H, Suzuki ... Inano H, Onoda M, Inafuku N, Kubota M, Kamada Y, Osawa T, Kobayashi H, Wakabayashi K: Chemoprevention by curcumin during the promotion stage of tumorigenesis of mammary gland in rats irradiated...
... following additional data are available with the online version of this paper Additional data file provides the human ALL gene set Additional data file provides the mouse ALL gene set Additional data ... duplicated genes We used five sequenced mammalian genomes: dog (Canis familiaris), cattle (Bos Taurus), rat (Rattus norvegicus), macaca (Macaca mulatta), and opossum (Monodelphis domestica) as outgroups ... Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, An P, et al.: Initial sequencing and comparative analysis of the mouse genome Nature 2002, 420:520-562 Thomas JW, Touchman JW,...
... were diagnosed with facet pain Primary outcome measure was percent change in facet-related pain as measured by Visual Analog Scale (VAS) score at final follow-up visit Secondary outcome was change ... investigate the long-term efficacy of facet debridement for the treatment of chronic back pain originating in the facet joint MATERIALS AND METHODS Patient enrollment and evaluation All patients treated ... 71% of 21 patients at one year follow-up with laser denervation of the dorsal facet capsule Li et al treated patients with RFA of the dorsal rami Three patients had durable response after to 16...
... 1145-9 Tamura N, Ogawa Y, Chusho H, et al Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 4239-44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic ... like to thank Dr Y Watanabe and Dr Y Izumi for collecting the samples, and Ms H Tobe, M Nakamura, and K Sugama for their technical assistance This work was supported financially by a grant from ... Japanese Circ Res 2000; 86: 841-5 13 Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K Isolation of the 5'-flanking region of genes by thermal asymmetric interlaced polymerase chain reaction...
... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential noveltherapeutic intervention in amyotrophic lateral sclerosis ... Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment of...
... Carbon Capture and Storage (CCS) Organic flocculants Primary Flocculation settlement tank and filtration CO2 Wetland plants Microalgae cultivation and reclamation Wastewater Artificial wetland ... system are wastes (wastewater, waste CO2), and the outputs are valuable products (reclaimed water, biofuel/biomass, organic fertilizer and organic flocculants) - 201 - Journal of Water and Environment ... be applied By separating microalgal cells from the wastewater, clean water with low content of organics and inorganic nutrients could be obtained, and also the microalgal biomass could be harvested...
... is associated with a domain or an organizational unit Security settings that are defined for a domain or organizational unit apply to all computers that are contained in that domain or organizational ... means that it is easy for an administrator to implement policies that can apply to all objects in a domain or a site, or can be applied merely to a small grouping of objects in an organizational ... this scenario, and then establish the requirements of the organization Scenario You are the administrator in an international pharmaceutical company, Contoso Pharmaceuticals This organization is...
... inverters can accommodate a wide range of input dc voltage for an improved energy output from variable wind turbine resources The input source and the output grid are separated based on flyback operation ... (DCM); the averaged current of Mode is the average output current of the inverter and can be expressed as, 230 vc is the capacitor voltage and is in the same order as the grid voltage The voltage stresses ... reference wave, serving as the modulating signal, is compared with a triangular wave, serving as the carrier signal The intersection points determine the switching angles and pulse widths as in Figure...
... the words validated, guaranteed, and verified are used interchangeably to denote that state enclosures are mathematically and not only empirically proven to be correct Traditional validated techniques ... engineering are analysis and design of robust, optimal, and adaptive controllers For nonlinear systems, robustness analysis with respect to uncertain initial states and parameters can be performed by calculating ... ode45s has been used with an equally spaced grid {ti }, ti − ti−1 = 5·10−4 Mean-value rule (MVR) evaluation and advanced interval methods (AIM) have been applied to evaluate the iteration formula...
... design of an organization „# Plan a domain upgrade to Active Directory Lab A, Developing a Domain Upgrade Strategy, is a scenario-based planning lab The students will collect information concerning ... restorations? A member of the Domain Admins How are backup tapes tested? The backup software runs a validation check on each tape A Backup Operator also verifies the backup tapes by performing a ... container, whereas global and local groups are placed in the Users container When the PDC of a child domain is upgraded to create a new domain, transitive trust relationships are automatically...
... between domains? All domains are located on a corporate local area network (LAN) and are connected by gigabit Ethernet At peak times, net available bandwidth averages 60% What is the Active Directory ... hardware available? Yes Each domain is allocated five spare servers that contain the exact hardware configuration of the servers currently in use What is the connectivity and bandwidth availability ... Maintain the source domain as a fallback mechanism until all migration operations are completed and tested „# Test to make sure that all migrated security principals, resources, and services are...
... technological innovation and the creation, accumulation and transmission of knowledge F J Forcadell and F Guadamillas Knowledge and Process Management CASE STUDY Figure Irizar chart Figure Organizational ... people’s active participation in knowledge creation and transmission in working teams is an essential cultural value At Irizar, participation is the A Knowledge Management Strategy Oriented to Innovation ... creation in organizations Working paper, University of New South Wales, Australia Teece D, Pisano G, Shuen A 1997 The dynamic capabilities and strategic management Strategic Management Journal...
... Canberra Manages the Finance department Cape Town Manages the purchasing department for the manufacturing division and ensures all offices maintain up-to-date external contact lists Lima Manages ... North America and Asia • North America and South Pacific • North America and South America • Europe and Africa Because each office employs a large number of mobile users, Northwind Traders wants ... e-mail messages Customizable Application Hosting The Web Storage System enables users and administrators to create customized applications, such as applications that automate employee and managementrelated...