a novel therapeutic strategy
Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf
... http://www.virologyj.com/content/5/1/135 (A) A T A A T T T A A T C (B) G C C G G/GATCCAAGCGGTCATCCGTATAATATTACCGGATGGCCGC/GGCCGCAAAAGAGCT/C C G BamHI NotI SacI T A A T C G T G G C G C C G AAG CGCCTTTTCCT original viral sequence ... CATGATCAACTGCTCTGATTAC GGGCTTCCCGTACTTTGTG TGGATTTAGCTCCCTGAATG TYLCV primers for Q-PCR (176 bp amplicon) Ty 2164+ Ty 2339- CTAAGAGCCTCTGACTTACTGC AACATTCAGGGAGCTAAATCCAG 200 nM 200 nM Actin2 ... GGTCGCTTCGACATARTCACG 200 nM 200 nM Sequencing of TYLCV cloned sequences pGreen1589 (+) pG1825(-) 579 (+) 1141 (+) 1741(+) 2321(+) CACGACGTTGTAAAACGACG CACAGGAAACAGCTATGACC GATGTTACTCGTGGATCTGG CATGATCAACTGCTCTGATTAC...
- 10
- 396
- 0
Bacteria in cancer therapy: a novel experimental strategy ppsx
... Cancer Res 2005, 65(9):3920-3927 54 Al-Ramadi BK, Fernandez-Cabezudo MJ, El-Hasasna H, Al-Salam S, Attoub S, Xu D, Chouaib S: Attenuated Bacteria as Effectors in Cancer Immunotherapy Ann N Y Acad ... 107) and DT-EGF have reached the stage of clinical trials in patients of brain tumor and metastatic carcinomas respectively [48] Similarly a large variety of antibodies and ligands to surface antigens ... bacteria, such as Clostridia and Bifidobacterium, will be evaluated in human clinical trials in the future New strains of bacteria being investigated as anticancer agents are: Salmonella choleraesuis,...
- 9
- 222
- 1
Báo cáo khoa học: " A new therapeutic strategy for lung tissue injury induced by influenza with CR2 targeting complement inhibitior" ppt
... function, and can expand small vessels and improve permeability; C 3a, C 4a and C 5a have anaphylatoxin function, and can degranulate mast cells and basophils, release vasoactive mediators and induce ... induce inflammatory reaction; C 3a, C 5a Page of and C5b67 have chemotaxis function, and can attract inflammatory cells to concentrate and migrate toward the inflammatory region activated by the ... which may induce inflammation again, damage the lung, and finally result in fatal pneumonia and acute respiratory tract infection syndromes This indicates that influenza patients require both antiviral...
- 4
- 220
- 0
Báo cáo khoa học: The modulation of metal bio-availability as a therapeutic strategy for the treatment of Alzheimer’s disease pptx
... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... and an increase in tau hyperphosphorylation Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid plaques that subsequently form may ... cycle has not been Fig Potential relationship between decreased intracellular metal bio-availability and the oxidative stress, tau hyperphosphorylation and extracellular Ab accumulation characteristic...
- 9
- 634
- 0
Báo cáo khoa học: Anti-arthritis effects of vitamin K2 (menaquinone-4) ) a new potential therapeutic strategy for rheumatoid arthritis doc
... conducted a caspase activity assay MK-4 activated caspase assay in a dose-dependent manner (Fig 2C) By contrast, vitamin K1 did not show any effects on caspase activity and DNA fragmentation (data not ... six patients with RA and synoviocytes were maintained in separate cultures These patients had active RA as defined by the clinical criteria of the American Rheumatism Association [25] All RA patients ... isothiocyanate apoptosis kit (Takara Bio Inc., Shiga, Japan) 4592 CIA model in rats Seven-week-old female dark agouti rats were obtained from Japan SLC, Inc (Shizuoka, Japan) 0.3% Collagen type...
- 7
- 455
- 0
Báo cáo khoa học: Sugar and alcohol molecules provide a therapeutic strategy for the serpinopathies that cause dementia and cirrhosis pot
... Janciauskiene S, Eriksson S, Callea F, Mallya M, Zhou A, Seyama K, Hata S & Lomas DA (2004) Differential detection of PAS-positive inclusions formed by the Z, Siiyama and Mmalton variants of a1 -antitrypsin ... LM, Lacbawan F et al (1999) Familial dementia caused by polymerization of mutant neuroserpin Nature 401, 376–379 Davis RL, Shrimpton AE, Carrell RW, Lomas DA, Gerhard L, Baumann B, Lawrence DA, ... retain its inhibitory activity against the target proteinase Experimental procedures Materials Ni-NTA agarose was from Qiagen (Crawley, UK), HiTrap Q-Sepharose and Ficoll PM70 were from Amersham...
- 13
- 494
- 0
báo cáo khoa học: " Polymeric nanoparticle-encapsulated curcumin ("nanocurcumin"): a novel strategy for human cancer therapy" ppsx
... NFκB κ MIAPaCa Figure 11 Nanocurcumin blocks activation of nuclear factor kappa B in pancreatic cancer cell lines Nanocurcumin blocks activation of nuclear factor kappa B in pancreatic cancer cell ... proliferation and antiapoptotic and metastatic gene products through suppression of IkappaBalpha kinase and Akt activation Mol Pharmacol 2006, 69:195-206 Hidaka H, Ishiko T, Furuhashi T, Kamohara H, Suzuki ... Inano H, Onoda M, Inafuku N, Kubota M, Kamada Y, Osawa T, Kobayashi H, Wakabayashi K: Chemoprevention by curcumin during the promotion stage of tumorigenesis of mammary gland in rats irradiated...
- 18
- 312
- 0
Báo cáo y học: "Quantifying the major mechanisms of recent gene duplications in the human and mouse genomes: a novel strategy to estimate gene duplication rates" docx
... following additional data are available with the online version of this paper Additional data file provides the human ALL gene set Additional data file provides the mouse ALL gene set Additional data ... duplicated genes We used five sequenced mammalian genomes: dog (Canis familiaris), cattle (Bos Taurus), rat (Rattus norvegicus), macaca (Macaca mulatta), and opossum (Monodelphis domestica) as outgroups ... Rogers J, Abril JF, Agarwal P, Agarwala R, Ainscough R, Alexandersson M, An P, et al.: Initial sequencing and comparative analysis of the mouse genome Nature 2002, 420:520-562 Thomas JW, Touchman JW,...
- 11
- 357
- 0
targeting cancer cell metabolism as a therapeutic strategy
... into acetyl-CoA and oxaloacetate by ATP citrate lyase (ACL) Fatty acid synthesis starts with acetyl-CoA carboxylase (ACC) Barbara Julieta Chaneton, 2014 34 converting acetyl-CoA to malonyl-CoA, and ... ALD, aldolase ALT, alanine transaminase AKT, protein kinase B AML, acute myeloid leukemia AMP, adenosine monophosphate AMPK, AMP activated protein kinase ASCT, amino acid transporter ATP, adenosine ... diphosphate ; ALD, aldolase ; ALT, alanine aminotransferase; ATP, adenosine triphosphate; CS, citrate synthase; ENO, enolase; FA, fatty acids; FAD, flavin adenine dinucleotide; FASN, fatty acid synthase;...
- 121
- 191
- 0
Báo cáo y học: "Endoscopic Facet Debridement for the treatment of facet arthritic pain – a novel new technique
... were diagnosed with facet pain Primary outcome measure was percent change in facet-related pain as measured by Visual Analog Scale (VAS) score at final follow-up visit Secondary outcome was change ... investigate the long-term efficacy of facet debridement for the treatment of chronic back pain originating in the facet joint MATERIALS AND METHODS Patient enrollment and evaluation All patients treated ... 71% of 21 patients at one year follow-up with laser denervation of the dorsal facet capsule Li et al treated patients with RFA of the dorsal rami Three patients had durable response after to 16...
- 4
- 599
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... 1145-9 Tamura N, Ogawa Y, Chusho H, et al Cardiac fibrosis in mice lacking brain natriuretic peptide Proc Natl Acad Sci USA 2000; 97: 4239-44 Mukoyama M, Nakao K, Saito Y, et al Human brain natriuretic ... like to thank Dr Y Watanabe and Dr Y Izumi for collecting the samples, and Ms H Tobe, M Nakamura, and K Sugama for their technical assistance This work was supported financially by a grant from ... Japanese Circ Res 2000; 86: 841-5 13 Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K Isolation of the 5'-flanking region of genes by thermal asymmetric interlaced polymerase chain reaction...
- 7
- 612
- 1
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral sclerosis ... Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment of...
- 8
- 499
- 0
Domestic Wastewater Reclamation Coupled with Biofuel/Biomass Production Based on Microalgae: A Novel Wastewater Treatment Process in the Future
... Carbon Capture and Storage (CCS) Organic flocculants Primary Flocculation settlement tank and filtration CO2 Wetland plants Microalgae cultivation and reclamation Wastewater Artificial wetland ... system are wastes (wastewater, waste CO2), and the outputs are valuable products (reclaimed water, biofuel/biomass, organic fertilizer and organic flocculants) - 201 - Journal of Water and Environment ... be applied By separating microalgal cells from the wastewater, clean water with low content of organics and inorganic nutrients could be obtained, and also the microalgal biomass could be harvested...
- 9
- 762
- 0
Tài liệu Module 6: Designing a Computer Management Strategy pptx
... is associated with a domain or an organizational unit Security settings that are defined for a domain or organizational unit apply to all computers that are contained in that domain or organizational ... means that it is easy for an administrator to implement policies that can apply to all objects in a domain or a site, or can be applied merely to a small grouping of objects in an organizational ... this scenario, and then establish the requirements of the organization Scenario You are the administrator in an international pharmaceutical company, Contoso Pharmaceuticals This organization is...
- 34
- 406
- 0
Research on a novel buck boost converter for wind turbine systems
... inverters can accommodate a wide range of input dc voltage for an improved energy output from variable wind turbine resources The input source and the output grid are separated based on flyback operation ... (DCM); the averaged current of Mode is the average output current of the inverter and can be expressed as, 230 vc is the capacitor voltage and is in the same order as the grid voltage The voltage stresses ... reference wave, serving as the modulating signal, is compared with a triangular wave, serving as the carrier signal The intersection points determine the switching angles and pulse widths as in Figure...
- 6
- 416
- 0
A novel interval method for validating state enclosures of the
... the words validated, guaranteed, and verified are used interchangeably to denote that state enclosures are mathematically and not only empirically proven to be correct Traditional validated techniques ... engineering are analysis and design of robust, optimal, and adaptive controllers For nonlinear systems, robustness analysis with respect to uncertain initial states and parameters can be performed by calculating ... ode45s has been used with an equally spaced grid {ti }, ti − ti−1 = 5·10−4 Mean-value rule (MVR) evaluation and advanced interval methods (AIM) have been applied to evaluate the iteration formula...
- 12
- 373
- 0
Tài liệu Module 3: Developing a Domain Upgrade Strategy doc
... design of an organization „# Plan a domain upgrade to Active Directory Lab A, Developing a Domain Upgrade Strategy, is a scenario-based planning lab The students will collect information concerning ... restorations? A member of the Domain Admins How are backup tapes tested? The backup software runs a validation check on each tape A Backup Operator also verifies the backup tapes by performing a ... container, whereas global and local groups are placed in the Users container When the PDC of a child domain is upgraded to create a new domain, transitive trust relationships are automatically...
- 44
- 372
- 0
Tài liệu Module 6: Developing a Domain Restructure Strategy doc
... between domains? All domains are located on a corporate local area network (LAN) and are connected by gigabit Ethernet At peak times, net available bandwidth averages 60% What is the Active Directory ... hardware available? Yes Each domain is allocated five spare servers that contain the exact hardware configuration of the servers currently in use What is the connectivity and bandwidth availability ... Maintain the source domain as a fallback mechanism until all migration operations are completed and tested „# Test to make sure that all migrated security principals, resources, and services are...
- 46
- 425
- 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf
... technological innovation and the creation, accumulation and transmission of knowledge F J Forcadell and F Guadamillas Knowledge and Process Management CASE STUDY Figure Irizar chart Figure Organizational ... people’s active participation in knowledge creation and transmission in working teams is an essential cultural value At Irizar, participation is the A Knowledge Management Strategy Oriented to Innovation ... creation in organizations Working paper, University of New South Wales, Australia Teece D, Pisano G, Shuen A 1997 The dynamic capabilities and strategic management Strategic Management Journal...
- 10
- 1,063
- 1
Tài liệu Module 5: Designing a Public Folder Strategy doc
... Canberra Manages the Finance department Cape Town Manages the purchasing department for the manufacturing division and ensures all offices maintain up-to-date external contact lists Lima Manages ... North America and Asia • North America and South Pacific • North America and South America • Europe and Africa Because each office employs a large number of mobile users, Northwind Traders wants ... e-mail messages Customizable Application Hosting The Web Storage System enables users and administrators to create customized applications, such as applications that automate employee and managementrelated...
- 40
- 232
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose