a novel possibility for accelerated bone defect healing
Bioreactor enhanced stem cell medicated osteoconducting scaffold for large bone defect healing
... healing capability, termed as a critical sized defect (CSD), it will fail to heal naturally and require the treatment of bone graft implantation to achieve defect union and healing In fact, bone ... mineral crystals are laid down parallel to each other, forming a bone matrix sheet, called a lamella Lamellas are laid down layer by layer, with the direction of collagen fibers of one layer (lamella) ... [Bolander, 1992; Andrew, 1994] A Inflammatory Phase - Vascular endothelial damage results in hematoma formation to immobilize the fracture and activate the cell responsible for repair B Reparative...
- 266
- 350
- 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
... Journal compilation ª 2008 FEBS No claim to original German government works 743 A novel route for geranial formation A Ilg et al to the peak area of the internal standard, which was quantified at ... Portais JC et al (2008) Strigolactone inhibition of shoot branching Nature 455, 189–194 11 Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Takeda-Kamiya N, Magome H, Kamiya Y, Shirasu 15 17 18 ... medium for 30 For HPLC analyses, cells were harvested after h, and carotenoids were extracted and processed as described above Analytical methods For HPLC analyses, a Waters system equipped with a...
- 12
- 497
- 0
Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt
... In all structures of canonical ACs, i.e mammalian AC, trypanosomal AC and mycobacterial AC Rv1264 the lysine-aspartate couple forms a salt bridge [5,7,26] Even in Rv1900c the asparagine-aspartate ... of the available structural data of canonical mammalian class IIIa and mycobacterial class IIIc catalytic domains [5,7,9,25] nor they parallel the findings on the noncanonical class IIIc AC Rv1900c ... because the canonical amino acids which define substrate specificity are replaced in a nonconservative manner, glutamine-asparagine instead of lysine-aspartate All mammalian membrane-bound ACs...
- 8
- 401
- 0
Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc
... culture PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER 978 Figure Histograms showing percentages of mitotic index (MI) and normal and abnormal metaphases of human brain cancer and ... therapy to treat 15 patients diagnosed with advanced intracranial malignant brain cancer at the PBH Research Foundation, Kolkata, India The other two authors (S.P and A. S.M.) have performed in vitro ... Multani AS, Ozen M, Narayan S, Kumar V, Chandra J, McConkey DJ, Newman RA and Pathak S: Caspase-dependent apoptosis induced by telomere cleavage and TRF2 loss Neoplasia 2: 339-345, 2000 12 Pathak...
- 8
- 670
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... of amplified message DNA ladder is marked M (A) HaCaT keratinocytes (lane 1); normal epidermal keratinocytes (lane 2); C1–4 squamous cell carcinoma (lane 3); dermal fibroblasts (lane 4); epidermal ... (lane 2) or black (lane 3) patients; melanoma WM35 (lane 4); normal epidermal keratinocytes (lane 5); HaCaT keratinocytes (lane 6); C1–4 squamous cell carcinoma (lane 7); dermal fibroblasts (lane...
- 11
- 475
- 0
Báo cáo khoa học: Investigations of the supercoil-selective DNA binding of wild type p53 suggest a novel mechanism for controlling p53 function doc
... scDNA (B) Ethidium stained agarose gel: lane 1, scDNA only; lane 2, no mAb; lanes 3–6, Bp53-10.1; lanes 7–10, ICA-9 mAb/p53 tetramer molar ratios: lanes and 7, 0.5; lanes and 8, 1.25; lanes and ... supernatants or ascites by means of affinity chromatography using either protein G-Sepharose (Pharmacia) or protein L-Sepharose (Pierce) horseradish peroxidase conjugated anti-rabbit IgG (Sigma) ... lanes and 7, no mAb; lanes and 8, DO-1; lanes and 9, ICA-9; lanes and 10, Bp53-6.1; lanes and 11, Bp53-10.1 Bands denoted as ÔscÕ and ÔocÕ correspond to free monomeric scDNA and open circular...
- 12
- 265
- 0
a novel method for the synthesis of titania nanotubes using
... crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere (Fig 12) Titania nanotubes prepared by the sonoelectrochemical method and annealed ... Mohapatra et al / Journal of Catalysis 246 (2007) 362–369 363 466 0A) After an initial increase-decrease transient, the current reached a steady-state value The anodized samples were properly washed ... in a nitrogen and oxygen atmosphere at 500 ◦ C for h in a CVD furnace at a heating rate of ◦ C/min The UAT samples annealed under these conditions are designated N2 -UAT and O2 -UAT The TiO2 nanotubes...
- 8
- 634
- 0
a novel method for the synthesis of cao nanoparticle
... surface area due to smaller particle and many non-aqueous solvents by adsorbing size and the reactive sites tailored in the form onto a broad range of materials, such as of edge and corner defects, ... decomposition applications of Co-Precipitation in the absence and presence nanosized metal oxides such as AP-MgO, AP- of Polyvinylpyrrolidone (PVP) as a capping CuO, AP-Fe2O3, AP-Al2O3 and AP-CaO [15 agent ... the final temperature (for min); the temperature 2-CEPS was increased at rate of 20 oC/ for 13 Also, detector temperature was 230 oC Experimental Materials Synthesis of CaO nanoparticles catalyst...
- 12
- 705
- 0
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot
... 18 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... extension to n-ary classification systems (e.g dim, intermediate, bright) is possible After derivation of frequencies for all sets, data was loaded into a relational database (MySQL) and analyzed with ... relational database (MySQL), and standard SQL statements and graphing utilities were used to interrogate the data Statistical tests were performed using the R software environment for statistical...
- 15
- 476
- 0
Báo cáo sinh học: " Body fluid derived exosomes as a novel template for clinical diagnostics" pptx
... Darmstadt, Germany) in an ABI 7300 analyzer Primers used for determining mRNA expression levels were as follows: CD24 fwd 5’-TGC CTC GAC ACA CAT AAA CC3’, CD24 rev 5’-GTG ACC ATG CGA ACA AAA ... AAA GA-3’; GAPDH fwd 5’-ACA CCC ACT CCT CCA CCT TT-3’, GAPDH rev 5’-TGC TGT AGC CAA ATT CGT TG-3’ To compare and quantify different measurements a cellular cDNA was used as standard and the amount ... esRNA was analyzed by PCR (C) Total RNA was isolated from amniotic fluid and urine exosomes and analyzed via an Agilent Bioanalyzer The results show that exosomes contain variable amounts of 18 and...
- 9
- 368
- 0
Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx
... Pain and self-reported characteristics Self-rated pain was assessed as pain at the moment and measured within a week before the day of testing on a blank 100 mm visual analogue scale (VAS), on ... engineering assistance, Maria Frykman for valuable assistance during data collection and Margaretha Marklund for graphical work References Competing interests The study was supported by funding from Alfta ... the data acquisition, and the statistical analyses and drafted the manuscript MBJ participated in the design and coordination of the study, the statistical analyses and helped to draft the manuscript...
- 10
- 712
- 0
báo cáo hóa học:" Body fluid derived exosomes as a novel template for clinical diagnostics" ppt
... Darmstadt, Germany) in an ABI 7300 analyzer Primers used for determining mRNA expression levels were as follows: CD24 fwd 5’-TGC CTC GAC ACA CAT AAA CC3’, CD24 rev 5’-GTG ACC ATG CGA ACA AAA ... AAA GA-3’; GAPDH fwd 5’-ACA CCC ACT CCT CCA CCT TT-3’, GAPDH rev 5’-TGC TGT AGC CAA ATT CGT TG-3’ To compare and quantify different measurements a cellular cDNA was used as standard and the amount ... esRNA was analyzed by PCR (C) Total RNA was isolated from amniotic fluid and urine exosomes and analyzed via an Agilent Bioanalyzer The results show that exosomes contain variable amounts of 18 and...
- 9
- 505
- 0
Báo cáo toán học: " A novel method for crystalline silicon solar cells with low contact resistance and antireflection coating by an oxidized Mg layer" ppt
... resistance To calculate the contact resistance, Mg was evaporated on the n-Si wafer, and the Ag paste was printed on the Si wafer for reference The contact resistances of Mg/Si and Ag/Si were measured ... Mater Sol Cells 2002, 73:209-219 Hilali MM, Nakayashiki K, Khadilkar C, Reedy RC, Rohatgi A, Shaikh A, Kim S, Sridharan S: Effect of Ag particle size in thick-film Ag paste on the electrical and ... ohmic contact with an n+ region, a new material can be inserted between Ag and Si to form low barrier height (ΦB) and thus to reduce the contact resistance Among various materials, Mg metal is selected...
- 14
- 648
- 0
Báo cáo hóa học: " TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization" pdf
... we can estimate DOAs and delays with only three MUSIC algorithm executions The original TSaT-MUSIC algorithm is for DOA-delay estimation in a 2D space and can easily be extended to a localization ... method in a 3D space One advantageous point of MUSIC algorithms used for 3D localization is that we can design a compact receiver array In this study, a small L-shaped receiver array (about 36 ... this article as: Mizutani et al.: TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization EURASIP Journal on Advances in Signal Processing 2011 2011:101 when a true point...
- 8
- 432
- 0
Báo cáo hóa học: " Research Article A Novel Method for Improving Fairness over Multiaccess Channels" pdf
... what we have in the corner points of the sum-capacity facet, we assume that all cancellations are perfect, and what is forwarded to the next decoder EURASIP Journal on Wireless Communications and ... show the Average AME for the six methods which are compared As it was already pointed out previously, OMA achieves always the maximum possible AME We can notice from Figure 2(b) that SIC and TS ... BORG∗ K is guaranteed to be max-min fair among all possible user groupings for which the sum capacity is achieved We investigate how the fairness can be evaluated for OMA, SIC, and BORG In this...
- 10
- 385
- 0
Báo cáo hóa học: "Research Article A Novel Criterion for Writer Enrolment Based on a Time-Normalized Signature Sample Entropy Measure" pptx
... functions available on all sorts of databases, whether acquired on fixed platforms (as digitizing tablets) or on mobile platforms (as Personal Digital Assistants) The entropy of a random variable only ... databases Such statistical approaches gave indeed the best signature verification results in the last Signature Evaluation campaign in the framework of BioSecure Multimodal Evaluation Campaign ... variability criteria were proposed for offline signature verification by a human expert A human operator labels signatures according to both criteria and their impact on performance is studied Also...
- 12
- 409
- 0
Báo cáo hóa học: " A Novel Route for Preparation of Hollow Carbon Nanospheres Without Introducing Template" ppt
... for h in all reactions) These varieties of products revealed that the content is a crucial factor for preparing carbon nanospheres in a large scale Because the carbonization process was actually ... realize polymerization and carbonization of alginate according to the theory of the rate of chemical reaction The filling ratio as an important parameter of hydrothermal systems has a critical ... may be explained why carbonization of alginate needed higher temperature than for carbonization of glucose Then nucleation of alginate took place when critical supersaturation of alginate was...
- 6
- 349
- 0
Báo cáo hóa học: " ZSBT: A Novel Algorithm for Tracing DoS Attackers in MANETs" pot
... onto a special ICMP packet, add information about the adjacent upstream and/or downstream routers, and send it towards the same destination as the original packet The victim of an attack can then ... attackers An enhancement to ITrace, known as ITrace-CP (ICMP traceback with cumulative path) [7], was proposed, thereby the ITrace-CP messages are made to carry the entire attack path information ... have proposed a small worldbased attacker traceback (SWAT) approach to trace DoS attacker in MANET They use traffic patterns matching (TPM) and traffic volume matching (TVM) as matching-in-depth techniques...
- 9
- 657
- 0
Báo cáo hóa học: " 3D-SoftChip: A Novel Architecture for Next-Generation Adaptive Computing Systems" pdf
... internal registers; a standard ALU with a bit-serial multiplier, adder, subtracter, and comparator, an embedded local SRAM and sets of registers The arithmetic primitives are scalable so as to make ... even greater EURASIP Journal on Applied Signal Processing Table 3: Standard PE functions Function A and B A or B A xor B A+ B A B A B A comp B |A| (Absolute value) 5.1 Mnemonics AND OR XOR ADD SUB ... 20th Anniversary Conference on Advanced Research in VLSI (ARVLSI ’99), pp 23–40, Atlanta, Ga, USA, March 1999 [14] E Waingold, M Taylor, D Srikrishna, et al., “Baring it all to software: raw machines,”...
- 13
- 228
- 0
Báo cáo y học: "γ A novel mechanism for the regulation of IFN-γ inducible protein-10 expression in rheumatoid arthritis" ppsx
... 5′-TGA-CTC-TAA-GTG-GCATTC-AAG-G (sense) and 5′-GAT-TCA-GAC-ATC-TCTTCT-CAC-CC (antisense) for IP-10 [24], and 5′-GTG-GGG-CGC-CCC-AGG-CAC-CA (sense) and 5′-CTC-CTT-AAT-GTC-ACG-CAC-GAT-TTC (antisense) for ... significant stimulatory or inhibitory effects were observed (Fig 3) Statistical analysis R76 Data were analyzed on a Power Macintosh computer using a statistical software package (Statview 4.5; Abacus ... contains molecular weight markers (100 base pair [bp] ladder) (b) IP-10 mRNA expression was quantified and normalized to β-actin as the IP-10/β-actin ratio Data are expressed as means ± SEM for...
- 8
- 446
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose