a novel approach for genetic immunization
Báo cáo y học: " Systems biology coupled with label-free high-throughput detection as a novel approach for diagnosis of chronic obstructive pulmonary disease" pptx
Ngày tải lên :
12/08/2014, 14:20
... vision, as others have also adopted this strategy as a way forward in molecular analysis Alagaratnam et al are utilising Bayesian approaches to pursue muscular dystrophy diagnosis [223] Similarly, ... 17(5):323-329 Ito M, Nakamura F, Baba A, Tamada K, Ushijima H, Lau KHA, Manna A, Knoll W: Enhancement of surface plasmon resonance signals by gold nanoparticles on high-density DNA microarrays J Phys Chem ... 51(12):2333-2340 Okamoto M, Kawabe T, Iwasaki Y, Hara T, Hashimoto N, Imaizumi K, Hasegawa Y, Shimokata K: Evaluation of interferon-gamma, interferon-gamma-inducing cytokines, and interferongamma-inducible...
- 17
- 377
- 0
Báo cáo y học: " A novel approach for prediction of tacrolimus blood concentration in liver transplantation patients in the intensive care unit through support vector regression" doc
Ngày tải lên :
13/08/2014, 08:20
... creatinine [CR] and urea [UR]) or liver dysfunction (alanine aminotransferase [ALT], aspartate aminotransferase [AST], gamma-glutamyl transpeptidase [GGT], total and conjugated bilirubin, alkaline ... the total amount of available data Variable selection for the MLR model In the MLR model also, the variable selection was performed with a forward, a backward, and a stepwise algorithm for simple ... input variables Background Hospital information systems in intensive care medicine generate large datasets on a daily basis These rapidly increasing amounts of data make the task of extracting...
- 7
- 318
- 0
A NOVEL APPROACH FOR MINING EMERGING PATTERNS IN DATA
Ngày tải lên :
16/09/2016, 17:12
... [9] H Fan, and K Ramamohanarao A Bayesian Approach to Use Emerging Patterns for Classification In Proceedings of the 14th Australasian Database Conference (ADC’03), Adelaide, Australia [10] Guozhu ... schema {A1 , A2 , A3 , An} A1 , A2 , A3 An are called attributes, and a1 , a2 , a3 , an are values related to these attributes We call each pair (attribute, value) an item Let I denote the set of all ... of machine learning databases Department of Information and Computer Science, University of California at Irvine, CA, 1999 [12] H Fan, and K Ramamohanarao An Efficient Single-Scan Algorithm For...
- 4
- 323
- 0
Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx
Ngày tải lên :
22/06/2014, 06:20
... directed acyclic graph (DAG) The objective function incorporates several constraints on the available silicon area (hardware capacity), B Knerr et al memory (software capacity), and latency as a timing ... constraints like time, area, power, throughput, delay, and so forth Hardware then usually addresses the implementation of a functional part, for example, performing an FIR or CRC, as a dedicated hardware ... The transformation of such systems into a task graph is therefore straightforward and rather trivial To be in accordance with most of the partitioning approaches in the field, we assume a graph...
- 13
- 310
- 0
Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx
Ngày tải lên :
09/08/2014, 04:21
... K, Yamaguchi T, Matsubara T, Takahashi T, Nakajima T, Muto T, Ikari T, Yanagisawa A, Kato Y: Proliferative activity of intrahepatic colorectal metastases after preoperative hemihepatic portal vein ... Kubota M, Matsuyama Y, Nakayama A, Miyagawa S, Makuuchi M, Kawasaki S: Preoperative portal vein embolization: an audit of 84 patients Hepatology 1999, 29:1099-1105 Page of (page number not for ... 21:434-439 Makuuchi M, Thai BL, Takayasu K, Takayama T, Kosuge T, Gunvén P, Yamazaki S, Hasegawa H, Ozaki H: Preoperative portal embolization to increase safety of major hepatectomy for hilar bile...
- 7
- 384
- 0
Báo cáo y học: "Rationale, design and methodology for Intraventricular Pressure Gradients Study: a novel approach f" doc
Ngày tải lên :
10/08/2014, 09:21
... conventional fashion Echocardiography All patients will have standard two-dimensional echocardiographic examinations before and after AVR LV ejection fraction is assessed visually by a trained echocardiographer ... this article as: Guerra et al.: Rationale, design and methodology for Intraventricular Pressure Gradients Study: a novel approach for ventricular filling assessment in normal and falling hearts ... that systolic and diastolic IVPG, a marker of normal left ventricular function, may be related to physiological asynchrony between basal and apical myocardial segments and that they can be attenuated,...
- 6
- 377
- 0
Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx
Ngày tải lên :
12/08/2014, 04:20
... codon)-3’ and the “second round PCR” (one -for- all) primer set: One -for- all-forward: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3’ and One -for- all-reverse: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTC-3’ PCR products containing ... in large scale as described by Soutscheck et al [12], rearranged in line assay format and validated with a number of pre-characterized serum samples These validation data confirmed the seroreactivity ... assays, data analysis and Page of wrote the manuscript KIP carried out large scale protein purification, microarray screen, line development and data analysis, participated in the coordination of...
- 9
- 750
- 0
Báo cáo sinh học: "A Bayesian approach for constructing genetic maps when markers are miscoded" ppsx
Ngày tải lên :
14/08/2014, 13:21
... [7] Gelfand A. E., Smith A. F.M., Sampling based approaches to calculating marginal densities, J Am Stat Assoc 85 (1990) 398–409 368 G.J.M Rosa et al [8] Geman S., Geman D., Stochastic relaxation, ... miscoding probability estimates, however, should raise concern about the molecular data, and a revaluation of the marker genotypes may be a good approach In situations with relatively large rates of ... the mistaken ordering of the loci, specially with dense maps Genetic map construction 357 BAYESIAN APPROACH FOR GENETIC MAP CONSTRUCTION First, we will review a Bayesian approach for map construction...
- 17
- 215
- 0
a decentralized approach for implementing identity management in cloud computing
Ngày tải lên :
31/07/2013, 09:43
... a hybrid misuse-anomaly detection approach to take advantage of anomaly detection’s ability to detect new attacks, but without the approach s accompanying high rate of false positives There are ... for IdM, Privacy and Identity Management for Europe (PRIME), Windows CardSpace, and OpenID Also they propose an entity-centric approach for IdM in the cloud that based on active bundles and anonymous ... anomaly behavior or not As demonstrated in [11], a basic assumption of anomaly detection is that attacks differ from normal behavior But the definition of what’s normal and what’s abnormal is ambiguous...
- 7
- 589
- 0
Tài liệu Focusing Resources on Effective School Health: A FRESH Approach for Achieving Education for All doc
Ngày tải lên :
14/02/2014, 09:20
... the Dakar Framework for Action during the World Education Forum (Dakar, 2000) are revitalising efforts to achieve Education for All In developing National Action Plans to achieve the goals and ... community, and take advantage of a skilled workforce (teachers and administrators) that is already engaged with individual and organisational partners in the local community As students become healthier, ... planners, administrators and teachers, at the local as well as national level, can participate in and benefit from this exchange 11 Systematically monitor progress towards EFA goals and strategies at...
- 30
- 417
- 0
Tài liệu Design for Sustainability a practical approach for Developing Economies doc
Ngày tải lên :
21/02/2014, 05:20
... Ethiopia Mr B.S Samarasiri, Moratuwa University, Sri Lanka Prof Dr John Turyagyanda, Makerere University, Uganda Dr Sonia Valdivia, UNEP DTIE, France Design and lay-out Ms Ana Mestre and Ms Gra a Campelo, ... Austria Mr Samantha Kumarasena, NCPC, Sri Lanka Mr Nguyen Hong Long, NCPC,Vietnam Ms Sophie Loran, UNEP DTIE, France Dr Diego Masera, UNEP Regional Office for Latin America and the Carribbean, ... spread as seen in the number of manuals and sectorspecific supporting materials that are available in many languages As a result, and based on experience, Ecodesign has evolved to encompass broader...
- 128
- 514
- 0
Báo cáo khoa học: Characterization of the rice carotenoid cleavage dioxygenase 1 reveals a novel route for geranial biosynthesis ppt
Ngày tải lên :
07/03/2014, 03:20
... Journal compilation ª 2008 FEBS No claim to original German government works 743 A novel route for geranial formation A Ilg et al to the peak area of the internal standard, which was quantified at ... Portais JC et al (2008) Strigolactone inhibition of shoot branching Nature 455, 189–194 11 Umehara M, Hanada A, Yoshida S, Akiyama K, Arite T, Takeda-Kamiya N, Magome H, Kamiya Y, Shirasu 15 17 18 ... medium for 30 For HPLC analyses, cells were harvested after h, and carotenoids were extracted and processed as described above Analytical methods For HPLC analyses, a Waters system equipped with a...
- 12
- 497
- 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
Ngày tải lên :
07/03/2014, 09:20
... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... Tsukuba T, Yamamoto S, Yanagawa M, Okamoto K, Okamoto Y, Nakayama KI, Kadowaki T & Yamamoto K (2006) Cathepsin E-deficient mice show increased susceptibility to bacterial infection associated with ... Hayakumo T & Nakajima M (1996) Expression of cathepsin E in pancreas: a possible tumor marker for pancreas, a preliminary report Int J Cancer 67, 492–497 22 Uno K, Azuma T, Nakajima M, Yasuda...
- 12
- 645
- 0
Báo cáo khoa học: Adenylyl cyclase Rv0386 from Mycobacterium tuberculosis H37Rv uses a novel mode for substrate selection ppt
Ngày tải lên :
07/03/2014, 21:20
... In all structures of canonical ACs, i.e mammalian AC, trypanosomal AC and mycobacterial AC Rv1264 the lysine-aspartate couple forms a salt bridge [5,7,26] Even in Rv1900c the asparagine-aspartate ... of the available structural data of canonical mammalian class IIIa and mycobacterial class IIIc catalytic domains [5,7,9,25] nor they parallel the findings on the noncanonical class IIIc AC Rv1900c ... because the canonical amino acids which define substrate specificity are replaced in a nonconservative manner, glutamine-asparagine instead of lysine-aspartate All mammalian membrane-bound ACs...
- 8
- 401
- 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc
Ngày tải lên :
15/03/2014, 10:20
... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address ... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3, ... Gambacorta, L and Marqués-Ibañez, D (2008), "Securitisation and the bank lending channel", European Economic Review (forthcoming) [3] Altunbas, Y., Gambacorta, L and Marqués-Ibañex (2009), "Bank...
- 30
- 911
- 0
A Conceptual Approach for Cannibalism Between Goods pot
Ngày tải lên :
16/03/2014, 11:20
... estudo exploratório dos fatores de marketing que contribuem para a sua ocorrência em indústrias alimentícias paulistanas (Dissertation: Master in Administração) Mackenzie, São Paulo (in Portuguese) ... greater risk the last one Currently, presumed private label brands account for a significant share of sales of retailers, particularly in the area of food The growth in size and share of own brands ... organizations that can cause cannibalism without benefits These instances related to top management decisions or the management practices of their products that include: a) strong top management...
- 5
- 366
- 0
One dimensional organic nanostructures a novel approach based on the selective adsorption of organic molecules on silicon nanowires
Ngày tải lên :
16/03/2014, 15:35
... L9 [2] H Sahaf, L Masson, C Leandri, B Auffray, G Le Lay, F Ronci, Appl Phys Lett 90 (2007) 263110 [3] M .A Valbuena, J Avila, M.E Davila, C Leandri, B Aufray, G Le Lay, M.C Asensio, Appl Surf ... filled states STM images of the surface following the evaporation of Å of THAP are displayed in Fig 3a and b Each molecule appears as a six-pronged shape with six bright lobes and a dark center ... structure as that observed upon adsorption on a clean Ag(1 0) surface [10] The reactivity of the Ag surface is presumably locally modified by the SiNWs, possibly by the formation a 2D surface Si–Ag alloy,...
- 5
- 465
- 0
Ruta 6 selectively induces cell death in brain cancer cells but proliferation in normal peripheral blood lymphocytes: A novel treatment for human brain cancer doc
Ngày tải lên :
22/03/2014, 17:20
... culture PATHAK et al: RUTA 6: A NOVEL TREATMENT FOR HUMAN BRAIN CANCER 978 Figure Histograms showing percentages of mitotic index (MI) and normal and abnormal metaphases of human brain cancer and ... therapy to treat 15 patients diagnosed with advanced intracranial malignant brain cancer at the PBH Research Foundation, Kolkata, India The other two authors (S.P and A. S.M.) have performed in vitro ... Multani AS, Ozen M, Narayan S, Kumar V, Chandra J, McConkey DJ, Newman RA and Pathak S: Caspase-dependent apoptosis induced by telomere cleavage and TRF2 loss Neoplasia 2: 339-345, 2000 12 Pathak...
- 8
- 670
- 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc
Ngày tải lên :
22/03/2014, 21:20
... and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and ... The fragments encoding Z variants were amplified from pUMZ-WT and pUMZ-K3 5A [7] using primers 5¢-TTTTGTCGACATGGCGCAACACGA TGAAGCCGTAGACAAC-3¢ and 5¢-AAAAGGATCCTT ATTTCGGCGCCTGAGCAT-3¢, and inserted ... DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into the NotI–SacI site of pLMZ -WT and pLMZ-K3 5A, yielding plasmids pLMZ-WT-H and...
- 9
- 356
- 0