a novel application of virtual reality for pain control virtual reality mirror visual feedback
Báo cáo y học: "Immediate determination of ACPA and rheumatoid factor - a novel point of care test for detection of anti-MCV antibodies and rheumatoid factor using a lateral-flow immunoassay" pdf
... article as: Renger et al., Immediate determination of ACPA and rheumatoid factor - a novel point of care test for detection of anti-MCV antibodies and rheumatoid factor using a lateral-flow immunoassay ... device Lateral-flow immunochromatographic assay (LFIA) was manufactured as double antigen direct sandwich assay Devices (DCN, Carlsbad, CA, USA) for testing of up to 10 μl of biological samples ... rheumatoid arthritis Arthritis Rheum 1994, 37:814-820 Hernandez-Garcia C, Vargas E, Abasolo L, Lajas C, Bellajdell B, Morado IC, Macarron P, Pato E, Fernandez-Gutierrez B, Banares A, Jover JA: Lag...
- 5
- 426
- 0
APPLICATION OF MPC ALGORITHM FOR TRACKING CONTROL
... where c is also a constant parameter All constant parameters of linearized and non-linear model are shown in the IFAC Benchmark problems [7], [8] Both linearized and non-linear systems have to meet ... responses of the plants are excellent for all cases The errors of tracking are in the range of ±0.1o for both the cargo vessel and oil tanker in terms of the linearized and non-linear models, ... errors are only in the range of ±0.05o for the cargo vessel and ±0.1o for the oil tanker In accordance with all case studies, the control parameters of the MPC algorithm, such as N p , N u is adjusted...
- 8
- 132
- 0
Application of PEEC modeling for the development of a novel multi gigahertz test interface with fine pitch wafer level package
... “Modeling and application of elastomer mesh for microwave probing,” IEE proceedings on Microwaves, Antennas and Propagation, Vol.153, No 1, pp.83-88, Feb 2006 J Jayabalan, R Jayaganthan, A. A.O Andrew ... availability of better CAD tools for the extraction of inductances and capacitances makes the PEEC models attractive PEECs are equivalent to Maxwell’s equations in the limit of an infinite lattice ... APPLICATION OF PEEC MODELING FOR THE DEVELOPMENT OF A NOVEL MULTI-GIGAHERTZ TEST INTERFACE WITH FINE PITCH WAFER LEVEL PACKAGE BY JAYASANKER JAYABALAN M.Sc.(Engg), National University of Singapore...
- 202
- 532
- 0
Báo cáo khoa học: A novel mechanism of V-type zinc inhibition of glutamate dehydrogenase results from disruption of subunit interactions necessary for efficient catalysis doc
... with alternative amino acid substrates GDH from mammalian sources is highly regulated by a diverse array of small molecules, with ADP, GTP, leucine and the combination of malate and palmitoyl CoA ... relative quantitation was achieved using the ratio of the height of the emerging peak to that of the undigested GDH For MALDI-TOF calibration purposes, BSA was used as a standard and was diluted ... phosphate buffer, pH 7.0, 0.5 mM NADP+, 20 mM glutamate amplitude and rate constant for the pre-steady state phase to be calculated The parameters for both the steady state phase and the pre-steady...
- 12
- 544
- 0
Báo cáo khoa học: Biosynthesis of D-arabinose in mycobacteria – a novel bacterial pathway with implications for antimycobacterial therapy pdf
... [26] The branched arabinan chains of the arabinogalactan are attached to the linear galactan backbone The arabinan consists of an inner linear region of Araf-(1 fi 5) -a- Araf and of branched non-reducing ... terminal Ara6 motifs: Arafb1 fi 2Arafa1 fi 5(Arafb1 fi 2Arafa1 fi 3)Arafa1 fi 5Arafa1 About two-thirds of the terminal b-Araf and the penultimate 2 -a- Araf serve as attachment sites for mycolic acids ... motifs: the Ara6 motif similar to that present in arabinogalactan, and a simplified linear Ara4 motif: Arafb fi 2Arafa1 fi 5Arafa1 fi 5Arafa1 Some of the non-reducing arabinofuranose termini are capped...
- 21
- 572
- 0
STUDY ON EPIDEMIOLOGICAL FEATURES, APPLICATION OF DIAGNOSTIC KIT FOR DETECTION OF TRYPANOSOMIASIS CAUSED BY TRYPANOSOMA EVANSI IN CATTLE AND BUFFALOES IN A FEW NORTHERN MOUNTAINOUS PROVINCES AND RECOMMENDATION FOR PREVENTIVE AND TREATMENT MEASURES
... evansi are higher than that of healthy mice * In rabbits: - Appearance time of T evansi in the blood of rabbit earliest on day and latest on day 14 after being experimentally infected Appearance ... Percentage (%) Stomoxys calcitrans Tabanus kiangsuensis Tabanus rubidus Stomoxys calcitrans Tabanus kiangsuensis Tabanus rubidus Stomoxys calcitrans Tabanus kiangsuensis Tabanus rubidus Stomoxys calcitrans ... informations of epidemiological and pathological features and effects of detection kits for diagnosis of trypanosomiasis,preventive and control measures of this disease in cattle and buffaloes...
- 14
- 590
- 0
báo cáo hóa học: "Initial development and testing of a novel foam-based pressure sensor for wearable sensing" doc
... the optimal locations for sensors In addition, processing algorithms for extraction of patterns from gathered data are required, as well as wearable and wireless hardware to allow the data to be ... edge of each scapula The sensors measured × × 0.5 cm Data was collected with the subject alternately supine and seated, on a hard surface Page of (page number not for citation purposes) Journal of ... University of Bath, England, showed that the stress-strain profile of the unadulterated PU foam sample and that of the PPy-coated PU foams sample were similar showing regions of elastic and inelastic...
- 7
- 748
- 0
báo cáo hóa học: " Reduced inclination of cervical spine in a novel notebook screen system - implications for rehabilitation" docx
... design, performed the analysis and interpretation of the data MFS, SU, KV, SM, BK: Participation in the analysis of data, revision of the manuscript All authors read and approved the final manuscript ... changes in the intradiscal pressure (PID) It has been suggested that an increased PID may worsen the alimentary status of the intravertebral disc that might contribute to a faster advancing of ... musculoskeletal disease a global perspective Clinical rheumatology 2006, 25:778-781 Kambin P, Abda S, Kurpicki F: Intradiskal pressure and volume recording: evaluation of normal and abnormal cervical disks...
- 6
- 536
- 0
Báo cáo hóa học: "Research Article A Novel Semiblind Signal Extraction Approach for the Removal of Eye-Blink Artifact from EEGs" potx
... K Nazarpour, S Sanei, and J A Chambers, A novel semiblind signal extraction approach incorporating PARAFAC for the removal of the removal of eye-blink artifact from EEGs,” in Proceedings of ... Time (s) Factor Factor Factor Factor (a) (b) The spatial signature of factor The spatial signature of factor (c) (d) Figure 6: The extracted factors by using PARAFAC; (a) and (b) illustrate, respectively, ... nonfrontal areas 3.3 Performance evaluations In order to provide a quantitative measure of performance for the proposed artifact removal method, the CC values of the extracted eye-blink artifact...
- 12
- 429
- 0
báo cáo khoa học: "A novel method of cultivating cardiac myocytes in agarose microchamber chips for studying cell synchronization" ppt
... the agar layer on the glass slide; (b) the agar at the focal point and on the light pathway started to melt; (c) when the focused beam was moved parallel to the chip surface, a portion of agar around ... cultivated in each hole of the agar microchambers on the chip as shown in Fig Collagen-type I (Nitta gelatin, Osaka, Japan) was coated on the glass layer surface to improve the attachment of the ... http://www.jnanobiotechnology.com/content/2/1/9 Figure (A) : Schematic drawing of the on-chip agar cultivation assay (A) : Schematic drawing of the on-chip agar cultivation assay (B): Optical micrograph of...
- 4
- 229
- 0
Báo cáo y học: "The boy who refused an IV: a case report of subcutaneous clodronate for bone pain in a child with Ewing Sarcoma" pot
... difficulty taking oral medications At the time of treatment his weight was 23 kg He had multiple pain complaints including headache, back pain and generalized arthralgia/myalgia There was a particularly ... used as laxatives The above regimen achieved satisfactory analgesia for all his pains except for bone pain in the arms The clinical team opted to try a bisphosphonate class drug for the bone pain ... use and by what route Cancer-related bone pain is a particularly difficult symptom to treat Bisphosphonates have gained acceptance as a standard approach to bone pain in adults In the idealized...
- 4
- 423
- 1
Báo cáo y học: "A novel human ex vivo model for the analysis of molecular events during lung cancer chemotherapy" pptx
... (GAPDH) (forward 5'AGAACGGGAAGCTTGTCATC; reverse 5'TGC-TGATGATCTTGAGGCTG) spanning an amplicon of 247 bp were always run in parallel for reasons of control RT-PCR products of caspase-3 were normalized ... TUNEL labelling assay, to further validate the importance of cleaved caspase-3 as a relevant biomarker for apoptosis In an ideal setup these data would have been correlated to actual patient ... 8:43 Additional material Additional File Fig A- B Immunohistochemical detection of activated caspase-3 in an exemplary human breast cancer tissue sample in the absence (A) or presence of gemcitabine...
- 11
- 573
- 0
Báo cáo y học: "Platelet-derived exosomes induce endothelial cell apoptosis through peroxynitrite generation: experimental evidence for a novel mechanism of septic vascular dysfunction" pot
... group of M.Z Ratajczak demonstrated that platelet microparticles could activate intracellular signaling pathways such as ERK and Akt, inducing angiogenesis and metastasis in lung cancer and promoting ... of DGK isoforms allows full activation of the diacylglycerol/Ras/extracellular signal-regulated kinase (ERK) cascade [38], which represents a pathway related to important vascular signaling effectors, ... idea of an accidental membrane fragmentation or from the apoptosis-associated bubbling of the plasma membrane, evidence accumulated during the past years has revealed a very specific process of...
- 12
- 290
- 0
Characteristics of communicative English A study on application of English teaching for non language major classes at Quang Binh University
... found at: National Library of Vietnam Library of Graduate academy of social siences Library of Institute of linguistics PREAMBLE Rational The tendency towards communicative language teaching ... the aim of having their communication goals Communicative approach is expanded under the viewpoint of seeing language as communication, the learner learn a forein language to have the ability of ... authentic, functional use of language for meaningful purposes Organizational language forms are not the central focus but rather aspects of language that enable the learner to accomplish those...
- 28
- 767
- 1
Cluster computing a novel peer to peer cluster for generic application sharing
... research a novel application sharing architecture was proposed for generic application sharing in a standard local area network This research is based on an original idea of a broker-mediated ... broker-mediated mechanism This application sharing system aims for sharing of application/ software resources with general applicability and scalability A novel application sharing architecture ... application sharing solutions and communication protocols enabling application sharing Chapter proposes a novel application sharing architecture for generic application sharing in a cluster of...
- 180
- 297
- 0
Identification of plant as a novel and alternative host model for burkholderia pseudomallei
... GAATTCCTCGAACCGTCCATCGTC 60.0 KHWTTSS2P2 GGATCCGATCGTGTCGAACGAGATCA 60.0 KHWTTSS2P3 GGATCCGGCATCGACGGTATTCT 66.9 KHWTTSS2P4 AAGCTTATATCGCCGGGATAGCGTA 66.9 BTTTSS2P1 aaGAATTCGGTGGCCTCCAGAAACAGT ... (5’-3’) Annealing Temperature (oC) 60.7 KHWTTSS1P1 GAATTCCGAACCGCTTTGTGATAACC KHWTTSS1P2 GGATCCGATCTTGAGCAGATGCTTG 60.7 KHWTTSS1P3 GGATCCGCCACGATATCCTCGAAAAG 60.7 KHWTTSS1P4 CTGCAGAGCTACGCCGTGAACGTATT ... BTTTSS2P2 aaGGATCCGAGGACCCGCATGACAAG 55.0 BTTTSS2P3 GGATCCGTGTCGCATCTGAAGGTGTC 55.0 BTTTSS2P4 AAGCTTACGAGCTGGTCGTTGATCTC 55.0 BTTTSS3P1 TTGAATTCGCATTGCGCGTATTTCTTTT 56.0 BTTTSS3P2 TTGGATCCTGATCGACGACTTCAAGCAG...
- 119
- 420
- 0
ứng dụng công nghệ enzyme để thu nhận đ-ờng chức năng fructooligosaccharide (FOS) từ dịch mía Application of enzyme technology for fructooligosaccharides (FOS) production
... -D fructofuranosidase chế phẩm pectinex Ultra SP-L v h m lợng đờng saccharose dịch m a Để có định hớng sử dụng chế phẩm enzyme pectinex-Ultra SP-L, hoạt tính enzyme -D frutofuranosidase đ đợc ... food Enzymology, 805 - 822p Mazza G Edt., 1998 Functional foods: Biochemical and processing aspects.Agriculture and agrifood, Canada, woodhead publishing Ltd ... William C.M., (2000) Functional foods - Concept to product Woodhead publishing Ltd & CRC Press - 27 p J.R.Whitaker, A. G.J.Voragen, D.W.S Wong, (2004) Handbook of food Enzymology, 805 - 822p Mazza...
- 7
- 849
- 2
Development of DMC controllers for temperature control of a room deploying the displacement ventilation HVAC system
... [19] Hasnain, S.M., Alawaji, S.H., A1 -Ibrahim, A and Smiai, M.S (1999), Application of Thermal Energy Storage in Saudi Arabia International Journal of Energy Research, vol 23, pp 117-124 [20] Zaheer-uddin, ... department of Mechanical Engineering and Materials Science at Washington University in St Louis, MO, USA He is a Fellow of ASME, AIAA, IEEE, and SAE E-mail address: rka@wustl.edu Huijun Gao received ... was created to simulate the temperature of the exterior wall of the room This temperature curve simulated the exterior surface and was assumed to be at a constant value of 320K A 3-D Cartesian...
- 12
- 556
- 0
Tài liệu Báo cáo khoa học: A novel type of highly negatively charged lipooligosaccharide from Pseudomonas stutzeri OX1 possessing two 4,6-O-(1-carboxy)-ethylidene residues in the outer core region ppt
... glycoform of the LOS has been found, with the typical oligosaccharide structure of a potential substrate for chain elongation and O-polysaccharide attachment [40–42] In this latter chain a rhamnose ... & Brade, H (1994) Preparation and structural analysis of oligosaccharide monophosphates obtained from the lipopolysaccharide of recombinant strains of Salmonella minnesota and Escherichia coli ... Negative ion MALDI-TOF mass spectra of oligosaccharide obtained in linear mode at normal (A) and higher laser intensity (B) Assignments of main ion peaks are shown P, phosphate; Pyr, pyruvic acid...
- 14
- 715
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25