a newly described human virus
Báo cáo y học: " Newly described human polyomaviruses Merkel Cell, KI and WU are present in urban sewage and may represent potential environmental contaminants" potx
... GGCTTTCTTTTTGAGAGGCCT GGCACACCAAAGAGTAACTCAAG CAGGTCATGTCTTCATTTAGGAG 1863-1849 Nested 232 54 GGAAGTGGAGCTTAATAAATTGG ATATCCATACAAGTCCTCAGAAG VP1, VP2 and VP3 = Virion protein 1, and 3; TAg = T antigen; ... 1617-1639 LN4 ATTTGGGTAATGCTATCTTCTCC GGATATATTTCTCCTGAATTACA First 423 54 1965-1943 LN3 GAATTAACTCCCATTCTTGGATTCA TTGGCTTCTTCCTCTGGTACT 4461-4439 LN1 TTGGGTAAACAGTTTTCTCCTG TGCCTAGATATTTTAATGTTACT 4492-4472 ... N, Clemente-Casares P, Hundesa A, Rodriguez-Manzano J, Allard A, Calvo M, Girones R: Quantification and stability of human adenoviruses and polyomavirus JCPyV in wastewater matrices Appl Environ...
- 5
- 211
- 0
báo cáo khoa học: "Splenic autotransplantation in a patient with human immunodeficiency virus infection: a case report" pot
... hospital after a car accident Anamnesis showed that our patient had been HIV-positive for 13 years No other information about our patient was available at that time, because he was in a life-threatening ... omentum can be a valid therapeutic choice in patients with HIV to balance the benefits and disadvantages of splenectomy Case report A 36-year-old Caucasian man was admitted to the shock trauma center ... autotransplantation and the immune system: adequate testing required for evaluation of effect Ann Surg 1992, 215:256-260 Takayasu H, Ishimaru Y, Tahara K, Otani Y, Yamagishi J, Ikeda H: Splenic autotransplantation...
- 3
- 283
- 0
Báo cáo y học: " Human herpes virus 8 replication during disseminated tuberculosis in a man with human immunodeficiency virus: a case report" pdf
... (normal range: 14-50 U/l), alanine aminotransferase 69 U/l (normal range: 12-50 U/l), alkaline phosphatase 350 U/L (normal range: 30-125 U/l), gamma-glutamyltransferase 271 umol/l (normal range: ... cytomegalovirus; DNA: deoxyribonucleic acid; HAART: highly active antiretroviral therapy; HHV-8: human herpesvirus 8; HIV: human immunodeficiency virus; KS: Kaposi's sarcoma; MCD: multicentric Castleman's ... generalized lymphadenopathy and hepatosplenomegaly The pathological examination of lymph nodes reveals angiofollicular hyperplasia, atrophic germinal centers surrounded by concentric layers of small...
- 5
- 352
- 0
Tài liệu Báo cáo khoa học: Receptor binding characteristics of the endocrine disruptor bisphenol A for the human nuclear estrogen-related receptor c pptx
... normalization to SEAP activities Each assay was performed in duplicate and repeated at least three times Acknowledgements We thank Professor Ian A Meinertzhagen, Dalhousie University, Canada, for reading ... manufacturer’s instructions SEAP activity was assayed by using Great EscAPeä SEAP assay reagent (Clontech Laboratories) according to the Fluorescent SEAP Assay protocol Light emission was measured ... IC50 (nM) Position 275 Position 316 BPA 4-OHT Glu Ala Asp Gln Leu Glu Glu Glu Ala Arg Ala Arg Arga Arg Arg Arg Arg Ala Lys Leu Ala Glu Glu Ala 9.70 ± 0.59 35.7 ± 5.48 36.7 ± 7.18 52.1 ± 8.99...
- 12
- 583
- 0
Tài liệu Báo cáo khoa học: Evidence for noncooperative metal binding to the a domain of human metallothionein ppt
... columns (Amersham Biosciences ⁄ GE Healthcare, Piscataway, NJ, USA), superfine G-25 Sephadex (Pharmacia ⁄ Pfizer, Oakville, ON, Canada) and a stirred ultrafiltration cell (Amicon Bioseparations ⁄ ... (Aldrich, Oakville, ON, Canada); isopropyl-b-d-thiogalactoside (Sigma-Aldrich, Oakville, ON, Canada); ammonium hydroxide (BDH Chemicals ⁄ VWR, Mississauga, ON, Canada); formic acid (J T Baker Chemical ... corresponding fraction of the metal-saturated Cd 4a species if the metallation mechanism proceeds by a positively cooperative pathway Alternatively, the partially filled Cd 1a, Cd 2a and Cd 3a intermediate species...
- 9
- 533
- 0
Báo cáo khoa học: A superoxide dismutase–human hemoglobin fusion protein showing enhanced antioxidative properties pptx
... dismutase catalase – absence of increased free radical generation following administration in a rabbit model of renal ischemia and reperfusion Free Radic Biol Med 24, 906–912 Alagic A, Koprianiuk A ... proteins, particularly when producing larger Hb conjugates As indicated earlier, catalase is a key component when generating functional Hb-based blood substitutes We have prepared an SOD–catalase fusion ... produce human Hb in microorganisms, because the a- chains and b-chains must be produced in equal amounts to give functional Hb molecules The a- chains are especially prone to precipitation and degradation...
- 9
- 389
- 0
Paper 8 a 3gbps/30k rule virus detection processor embedded
... Proposed Virus- Detection Processor Virus detection is split into two phases and support new modified algorithms by hardware Filtering Engine: handle >80% input data Exact-Matching Engine: ... them by merging two algorithm’s data Chip Micrograph and Features Contribute a high-performance, low-power and low-cost virus- detection processor Support 3Gbps real-time virus detection for ... Exact-Matching Engine:
- 3
- 294
- 0
Báo cáo khoa học: Effects of the G376E and G157D mutations on the stability of yeast enolase – a model for human muscle enolase deficiency pdf
... QuickChange method (Stratagene, La Jolla, CA, USA) The primer sequences were as follows: 5¢-GG GGT GTT ATG GTT TCC CAT CGA TCT GAA GAA ACT GAA GAC (G376E) and 5¢-CCA TTC TTG AAC GTT TTA AAC GGT GAT ... Functional Genomics) for running many of the analytical ultracentrifugation samples, A Padovani for making the W56F variant and J A Kornblatt for encouragement and advice Financial support was provided ... 157 and 376 are space-filled 98 Analytical ultracentrifugation (AUC) was used to examine the quaternary structure of the variants Wild-type enolase and the G157D variant had the same sedimentation...
- 10
- 520
- 0
Báo cáo Y học: Expression pattern in the antennae of a newly isolated lepidopteran Gq protein a subunit cDNA potx
... trichodea) are located on the lateral part of the ventral area and are arrayed in four to five parallel rows [32] (Fig 4A, white arrows) Short sensilla trichodea are located medio-ventrally and are ... D., Terakita, A. , Ishikawa, T., Tsukahara, Y., Maeda, A & Shichida, Y (1997) A novel Go-mediated phototransduction cascade in scallop visual cells J Biol Chem 272, 22979–22982 Iwasa, T., Yanai, ... antennae and from primary antennal cell culture of M brassicae were separated by SDS/PAGE and analysed by Western-blot using a Gq/11 a antiserum (Fig 1) Crude homogenates of male and female antennae...
- 10
- 619
- 0
Báo cáo khoa học: Characterization of eIF3k A newly discovered subunit of mammalian translation initiation factor eIF3 potx
... Mayeur et al (Eur J Biochem 270) Materials and methods Materials eIF3 was prepared from human HeLa cells as described previously [22] Polyclonal antiserum against rabbit eIF3 was prepared in a ... zb98c06.r1 was amplified by PCR with the forward primer 5¢-CCCATATGGCCATGGCGA TGTTTGAGCAG-3¢ and reverse primer 5¢-GCTCGAGA AGCTTACTGGGAGGAGGCCATG-3¢ (restriction sites are in bold and eIF3k start and ... BL21 and purified according to manufacturer’s instructions (Amersham Pharmacia) The amount of cell lysate incubated with the beads was adjusted so that a similar amount of each subunit was bound...
- 7
- 256
- 0
the straight dope a compendium of human knowledge
... Vlkoslak Neuntoter Vampiro Albania Bavaria Bohemia Bulgaria Crete Greece Hungary Ireland Macedonia Poland Prussia Rumania Serbia Saxony Spain Stake through heart Place coin in mouth, decapitate ... from the autumnal appearance of the hordes, I'd mark the arrival of the contraband roach around early summer (the eggs take 30-60 days to hatch) Although roaches have no real "season" all their ... Light a couple candles and put on some Mantovani (rats are suckers for cheap romance) Put the traps near any likely rat habitat, meaning any cool, dark, moist, concealed place, such as under a cupboard...
- 272
- 206
- 0
temple univ pr food and evolution toward a theory of human food habits jan 1987
... Bangladesh (Lindenbaum), Amazonia (Johnson and Baksh, Good, Ross), Paraguay (Hawkes), Canadian sub-arctic (Winterhalder), Southeast Asia and Africa (Franke), Mexico (Pelto), Costa Rica (Edelman), ... preferences and avoidances, dominate data collection On the other hand, etic foodways data not necessarily require eliciting operations and are reported in a data language whose units and categories are ... paca, are traditionally tabooed" (1972:68-69), while Basso has noted that the Kalapalo, vv-ho inhabit the rich river and lake network of the Upper Xingu, "regard virtually all land animals as...
- 645
- 298
- 0
báo cáo hóa học:" A highly invasive human glioblastoma pre-clinical model for testing therapeutics" pot
... Wenkert and Yuehai Shen for 17AAG characterization and to Drs Jacob Zhang and Kyle Furge for statistical analysis We thank Michelle Bassett for assistance in the preparation of the manuscript We thank ... Clin Cancer Res 2007, 13:1783-1788 Ramanathan RK, Egorin MJ, Eiseman JL, Ramalingam S, Friedland D, Agarwala SS, Ivy SP, Potter DM, Chatta G, Zuhowski EG, et al.: Phase I and pharmacodynamic study ... Shidham V: FNAB cytology of extra-cranial metastasis of glioblastoma multiforme may resemble a lung primary: a diagnostic pitfall Cytojournal 2005, 2:9 Saad AG, Sachs J, Turner CD, Proctor M, Marcus...
- 13
- 413
- 0
Báo cáo sinh học: " A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" pptx
... cells At an MOI of 0.1 or 0.5 there was an average reduction of 99.1% of infectious virus particles (Fig 2) At an MOI of there was an average reduction of 95.7%, and at an MOI of 10 there was an average ... coordinated the research efforts and edited the paper Both authors read and approved the final manuscript Acknowledgements We kindly thank Dr Paula Traktman for the vTetR virus strain and for ... panels A, B, D, E, and F represents 400 nm The bar in panel C represents 200 nm G1L are associated with the immature virus along with the accompanying DNA and other viral proteins, then activation...
- 6
- 300
- 0
Báo cáo sinh học: " Panicovirus accumulation is governed by two membrane-associated proteins with a newly identified conserved motif that contributes to pathogenicity" pptx
... CTCCAGACAGCCGCCTGGTTAGC CACACCCTGTAGAGGGCTCTCCAG CCTTTCTTATCAGCCACCCTGTAGAG GGAATACAGCTGGCAAGGC TGATCCTGGGCGTATGCGC GCCCCAACTAATGCATTGGTCACTAG CCAAGCAGTCGCATTGGCCCC a The altered nucleotides on the PMV cDNA are ... P31 7A- 989R N32 3A- 1007R L32 5A- 1014R REP/Y -A 1044R-C /A REP/F -A REP/D -A MUTPMV-1236R REP/W -A CCCCAGCGGCTTCGTTCTTTGC GGAACCCCAGCAAACTCGTTCTTTGC CTGTGGGTTTTGCAACCCCAGCG CAGCCAACTGGGCAGCCTCTGTG CTCCAGACAGCCGCCTGGTTAGC ... plants CD mutations not affect RNA cis-elements Many RNA viruses contain RNA cis-elements that can affect replication To test if amino acid changes (F31 3A, F35 7A, and W405) may have inactivated...
- 12
- 307
- 0
Báo cáo hóa học: " Complete genome of a European hepatitis C virus subtype 1g isolate: phylogenetic and genetic analyses" pptx
... Innovación Tecnológica (I+D+I); and by grant 2007FIC00550 (VS) from Comissionat per a Universitats i Recerca del Departament d'Innovació, Universitats i Empresa de la Generalitat de Catalunya i ... matrix Distance model was GTR+I+G with assumed proportion of invariable sites of 0.42 and a shape parameter (alpha) of 1.02 for the gamma distribution of substitution rates at variable sites ... which only partial sequences are known, have been denoted as provisional In addition, a complete genotype sequence from an Equatorial Guinea isolate with unassigned subtype is also available [4]...
- 7
- 434
- 0
báo cáo hóa học:" A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" potx
... cells At an MOI of 0.1 or 0.5 there was an average reduction of 99.1% of infectious virus particles (Fig 2) At an MOI of there was an average reduction of 95.7%, and at an MOI of 10 there was an average ... coordinated the research efforts and edited the paper Both authors read and approved the final manuscript Acknowledgements We kindly thank Dr Paula Traktman for the vTetR virus strain and for ... panels A, B, D, E, and F represents 400 nm The bar in panel C represents 200 nm G1L are associated with the immature virus along with the accompanying DNA and other viral proteins, then activation...
- 6
- 208
- 0
uncharted_ big data as a lens on human culture-erez aiden
... absolute pageturner, it fascinated us from cover to cover, from the dramatic beginning: Chapter One A AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAA And all the way through the surprising finish: Chapter ... describe all sorts of observations that can be made using a culturomic approach We’ll talk about what our ngram data has revealed about how English grammar changes, how dictionaries make mistakes, ... result was a novel mathematical analysis of ordinary human movement, executed at the scale of whole cities Barabási and his team got so good at analyzing movement histories that, occasionally,...
- 336
- 488
- 0
Tài liệu tham khảo a theory of human motivation
... considered to be a psychological threat With a few exceptions, all psychopathology may be partially traced to such threats A basically thwarted man may actually be defined as a 'sick' man, if we wish ... that these physiological drives or needs are to be considered unusual rather than typical because they are isolable, and because they are localizable somatically That is to say, they are relatively ... simply as a sick man This is a fair parallel to our designation as 'sick' of the man who lacks vitamins or minerals Who is to say that a lack of love is less important than a lack of vitamins? Since...
- 25
- 435
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose