a new variable in career decision making
Women''''s autonomy in household decision-making: a demographic study in Nepal potx
... Women in paid employment also have a higher say in decision making Women with more living children (5+) have greater participation in decision making for each outcome variable Making major household ... participation and household decision making in Nepal, a working paper (526) for the World Bank, Washington DC 1983 Senarath U, Gunawardena NS: Women's autonomy in decision making for health care ... women's autonomy in decision making (Table 3) Age shows a positive relationship to decision making in all four outcomes; younger women are less likely to participate in decision making than older...
- 12
- 543
- 0
a new dataset in the making
... Johanna Bötscher, Martina Castro, Kristina Hauser, Benjamin Hofmann, Theresa Kuhn, Salome Lang, Justin Leinaweaver, Julie Mandoyan, Martiño Rubal Maseda, Claudia Meier, Irina, Mirkina, Katharina ... Foreign Affairs and International Trade Canada website: http://www.international.gc.ca/tradeagreements-accords-commerciaux/agr-acc/index.aspx some information as to planning and process of coding and ... Percentage 20 25 National treatment no National treatment yes Percentage America Oceania Region 30 Region Africa Europe Asia Africa America Oceania Region Cross Europe Asia Africa America Oceania...
- 47
- 414
- 0
báo cáo khoa học: "Determinants of research use in clinical decision making among physical therapists providing services post-stroke: a cross-sectional study" potx
... Results indicate that a third of physical therapists use research findings in clinical decision making rarely or not at all, and only 13.3% of therapists integrate research in clinical decision making ... research findings in clinical decision making rarely, that is, or time in a typical month, compared to approximately 49% that reported use to times in a typical month In a survey of 124 Australian ... facilitate the incorporation of research findings into clinical decision making That both EBP self-efficacy and research participation remained significant in the final model after adjusting for the...
- 9
- 321
- 0
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"
... trifluoroacetic acid in water (A) and 60% acetonitrile in water (B) as eluent The conjugate was eluted with a successive linear gradient, increasing from 25% to 60% B-eluent in 49 at a flow rate of ... grey-values and differential relaxation times are unsatisfactory so far, because radiation induced necrosis [58], vital tumor tissue and cerebral metastases are nearly undistinguishable.[51] Additionally, ... slowly added at 0–5°C The resulting deeply colored solution was maintained at room temperature for h Then the organic phase was washed with water, followed by 1N-HCl and again water The organic layer...
- 11
- 655
- 0
CHAPTER ELEVEN MIND MAPPING a NEW DIMENSION IN THINKING AND NOTE TAKING
... Outlining On page 109 is a Mind Map summarising a three-day Brain Training and Mind Mapping Course The Mind Map was made by a father who was also a company director He used the same Mind Map to ... Key words or phrases for main and secondary ideas from Kusa-Hibari main secondary paragraph paragraph paragraph paragraph paragraph Below you will find sample key words and phrases from the notes ... structure of the brain Advanced note taking and mapping techniques 86 NOTING Exercise In the space below, and starting immediately after having reached the end of this paragraph, prepare a half-hour speech...
- 52
- 671
- 0
Tài liệu A Leader’s Framework for Decision Making ppt
... David J Snowden and Mary E Boone In January 1993, a gunman murdered seven people in a fast-food restaurant in Palatine, a suburb of Chicago In his dual roles as an administrative executive and ... of each individual’s entrained thinking—or ego Working in unfamiliar environments can help leaders and experts approach decision making more creatively For instance, we put retail marketing professionals ... contexts page A Leader’s Framework for Decision Making new cell phone might emphasize feature A over feature B, but an alternative plan—emphasizing feature C—might be equally valuable Another example...
- 10
- 745
- 0
Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx
... 2002 Toward a unified approach to statistical language modeling for Chinese ACM Transaction on Asian Language Information Processing, 1(1):3–33 Jianfeng Gao, Mu Li, Andi Wu, and Chang-Ning Huang 2004 ... to increase total path probability mass This can be amended by involving the discriminative language model adaptation in the iteration, which results in a unified language model and lexicon adaptation ... chart in Figure At the beginning we are given an adaptation spoken corpus and manual transcriptions Based on a baseline lexicon (Lex0 ) and a language model (LM0 ) we perform ASR on the adaptation...
- 9
- 466
- 0
Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization field pptx
... 269) Table Glycosaminoglycan analysis and calcium measurements of the water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre Sulfated and nonsulfated ... estimated by the Whiteman Alcian blue binding technique [28,29], using chondroitin sulfate as standard The assay was adapted to the estimation of GAG in more dilute samples by increasing the aliquot ... kDa) and lysozyme (17 kDa) resolved for EDTA-SM than for WSM (Fig 2) The main peak from each separation, indicated by an asterisk in Fig 2, was collected and submitted to amino acid analysis Amino...
- 10
- 731
- 0
JUDGMENT IN MANAGERIAL DECISION MAKING doc
... development, bank loans, and performance appraisal Chapter 7: Fairness and ethics in decision making When people care about fairness? When will individuals accept suboptimal outcomes in order to maintain ... batting average in one season always has the highest batting average the next season 18 Chapter 2: Common Biases BIASES EMANATING FROM THE AVAILABILITY HEURISTIC Bias 1: Ease of Recall (based ... clear data about how to avoid contracting AIDS In the fall of 1991, however, sexual behavior in Dallas was dramatically affected by one vivid piece of data that may or may not have been true In...
- 242
- 2,699
- 1
Women in economic decision-making in the EU: Progress report pdf
... Brazil, and China), GMI Ratings (Mexico, and Japan), academic thesis “An economic analysis of the impact of women’s quota in Argentina’s corporate boards” by Gabriela Colombo (Argentina), Cranfield ... (USA and Canada), European Commission Database on women and men in decision- making (EU-27), Australian Boardroom Diversity Index (Australia), “Women Matter” Report McKinsey & Company (Russia, ... codes, charters, training, mentoring and networking programmes, as well as databases promoting female candidates Voluntary measures have the advantage of greater flexibility and an enhanced sense...
- 28
- 264
- 0
scientific american - 2002 06 - spintronics - a new twist in computing
... Thailand are based on a combination of clades B and E, and in April the International AIDS Vaccine Initiative expanded tests of a clade A derived vaccine in Kenya, where clade A is found But in January, ... primates SOUTH CHINA SEA MALAYSIA BORNEO SUMATRA INDONESIA INDIAN OCEAN JAVA Present-Day Orangutan Range HUNDREDS OF THOUSANDS of orangutans roamed throughout Southeast Asia about 10,000 years ago, ... (20,000 in North America) Although several potential AIDS vaccines are in clinical tests, so far none has lived up to its early promise Time and again researchers have obtained tantalizing preliminary...
- 87
- 798
- 0
Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc
... CytoDyn Amerimmune Pharmaceuticals, Inc TIPRANAVIR AAI International, AnaaiPharma Company MedImmune MedImmune MedImmune Inspire Pharmaceuticals Genital Warts HPV Hepatitis B Hepatitis B Hepatitis ... OraQuick HIV-1 Cytolin Tipranavir HXB MEDI-491 Synagis™ (Palivizumab) Numax INS37217 Intranasal MedImmune Nabi Biopharmaceuticals Protein Design Labs XTL Biopharmaceuticals Ltd Nabi Biopharmaceuticals ... limited by insufficient efficacy and unfavorable pharmacokinetics MAbs have increasingly gained favor in large part because of the development of chimeric, humanized, and human antibodies have reduced...
- 6
- 568
- 0
báo cáo hóa học: " Intention as an indicator for subjective need: A new pathway in need assessment" doc
... study and at the data acquisition followed by data preparation for the current analysis RP participated at data acquisition and data preparation for the current analysis TU participated in the ... two background variables In model (M3) the outcome variable was regressed onto the background variables, interaction, and psychological distress After that, a similar modelling strategy was applied ... Petukhova M, Chatterji S, Aquila-Gaxiola S, Alonso J, Angermeyer MC, Bromet EJ, Burger H, Demyttenaere K, de Girolamo G, Haro JM, Hwang I, Karam E, Kawakami N, Lépine JP, Medina-Mora ME, Posada-Villa...
- 10
- 367
- 0
báo cáo hóa học:" Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" pdf
... CytoDyn Amerimmune Pharmaceuticals, Inc TIPRANAVIR AAI International, AnaaiPharma Company MedImmune MedImmune MedImmune Inspire Pharmaceuticals Genital Warts HPV Hepatitis B Hepatitis B Hepatitis ... OraQuick HIV-1 Cytolin Tipranavir HXB MEDI-491 Synagis™ (Palivizumab) Numax INS37217 Intranasal MedImmune Nabi Biopharmaceuticals Protein Design Labs XTL Biopharmaceuticals Ltd Nabi Biopharmaceuticals ... limited by insufficient efficacy and unfavorable pharmacokinetics MAbs have increasingly gained favor in large part because of the development of chimeric, humanized, and human antibodies have reduced...
- 6
- 561
- 0
Desiccant enhanced evaporative air-conditioning (DEVap): evaluation of a new concept in ultra efficient air conditioning docx
... does in building spaces only Today’s A/ C systems: • Maintain a healthy building environment o In commercial and new residential, A/ C provides ventilation air to maintain indoor air quality o A/ C ... http://www.simpopdf.com Acronyms and Abbreviations AAHX air-to-air heat exchanger AILR AIL Research A/ C air-conditioning CHP combined heat and power COP coefficient of performance DEVap desiccant-enhanced evaporative ... remaining refrigerants used today (R41 0A and R-13 4A) are strong contributors to global warming Their global warming potentials are 2000 and 1300, respectively (ASHRAE 2006) Finding data on air...
- 61
- 423
- 0
Báo cáo y học: "Human depression: a new approach in quantitative psychiatry" pdf
... an active complex that mediates an intracellular event (for example, activation of adenylate cyclase) The Gα subunit is activated and starts a cAMP signalling cascade, as shown in Figure The international ... the data All the authors have been involved in drafting and revising the manuscript and have read and approved the final manuscript Author Details 1DIMORFIPA, University of Bologna, Italy, 2Faculty ... subjects in the two intermediate areas (yellow and orange) have been interpreted as having a misleading diagnosis of major depression, as described in the literature [14] (b) SOM areas Green = normal,...
- 6
- 435
- 0
Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx
... blockade for 14 days in a patient with rheumatoid arthritis (haematoxylin–eosin staining; original magnification ×400) After active treatment there was a marked reduction in synovial cellularity, ... the initial data are promising It can be anticipated that several clinical trials exploring this approach will be reported in the near future Competing interests Conclusion The available data in ... migration selectively [20] In that study a highly specific neutralizing antibody against IL-8 was administered in several types of acute inflammatory disease, including lipopolysaccharide/IL-1 induced...
- 5
- 460
- 0
Báo cáo y học: "Soluble IL-18 receptor complex: a new star in the firmament of rheumatoid arthritis diagnosis" pptx
... Matsunaga K, Sakazaki Y, Sawada M, Oda H, Takenaka S-I, Imaoka H, Kinoshita T, Honda S, Ida S, Fukuda T -A, Aizawa H: Soluble interleukin-18 receptor complex is a novel biomarker in rheumatoid arthritis ... protein expression in synovial tissue did correlate with serum CRP and disease activity in inflammatory arthritis [12], indicating a local role in the pathophysiology of disease A comparative ... amyloid A, alpha 1-antitrypsin, and apolipoproteins in the blood [6] In principle, carbohydrates, lipids and proteins (including enzymes, matrix proteins or their neoepitopes, autoantibodies, acute-phase...
- 3
- 294
- 0
Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt
... 5'TTCCTGAGGGCTCACTGATTAAC and 5'-GAAGGGGAGAGTCAGTTGTTGGAG (external to the ORF) or 5'AGACTGCGGAGATAAAACTGC and 5'-gataaaggtcatcagcctattga (internal to the ORF) PCR products were then cloned in pGEM-T ... cellular and a syncytial trophophoblast layer separating maternal and fetal blood spaces (maternal lacuna, ml, and fetal vessels, fv) All of these characterize the definitive labyrinthine placenta ... stained with haematoxylin and eosin or used for in situ hybridization A PCR-amplified 1135 bp syncytin-Ory1 fragment (primers: 5'-AGACTGCGGAGATAAAACTGC and 5'GTGGACCGCGATTCCTAGTC) was cloned into...
- 11
- 354
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008