0

a new approach to the problem of human interrelations

Báo cáo khoa học:

Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf

Báo cáo khoa học

... give an illustration of the behavior of the morphological and syntactic parsers on a more complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo ... 07974. Barbara Brunson* AT&T Bell Laboratories and Department of Linguistics University of Toronto Toronto, Ontario, Canada M5S 1A1 . Abstract We present a model of morphological processing ... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central to the task of a morphological analyzer and, hence, have incorporated...
  • 8
  • 522
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Word Sense Induction" doc

Báo cáo khoa học

... judgment, all words in the upper branch of the hierarchical tree are related to the hand sense of palm, and all other words are related to its tree sense. However, it is somewhat unsatis-factory ... vectors. To see this, let us bring our attention to the various species of ani-mals that are among the top 30 associations to poach. Some of them seem more often affected by cooking (pheasant, ... consid-ered as one of its senses. A problem that we see with this approach is that it allows only as many senses as clusters, thereby limiting the granularity of the meaning space. This problem is avoided...
  • 4
  • 536
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học

... CCCCATGTCGCCTTTAGTOMCB-KO-R TCGCTAGAACACATTGACOMCA-F ATGATGAAACGGTTCAATOMCA-R TTAGTTACCGTGTGCTTCOMCB-F CTGCTGCTCGCAGCAAGTOMCB-R GTGTGATCTGCAACTGTTOMCA-PBAD-F CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R ... CACCGAGGAATAATAAATGATGAAACGGTTCAATTTCOMCA-PBAD-R TTAGTTACCGTGTGCTTCOMCB-PBAD-F CACCGAGGAATAATAAATGATGAACGCACAAAAATCAOMCB-PBAD-R TTACATTTTCACTTTAGTShewanella oneidensis MR-1 OmcA and OmcB kinetics J. Borloo et al.3736 ... MR-1R was used as a positive control to display omcA(lane 1) and omcB (lane 6). DNA standards are indicated at the leftand right of the agarose gels. (B) Visualization and separation of high...
  • 11
  • 731
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Practical Solution to the Problem of Automatic Part-of-Speech Induction from Text" pdf

Báo cáo khoa học

... vector comparisons. Fortunately, the problem of data sparseness can be minimized by reducing the dimensionality of the matrix. An appropriate alge-braic method that has the capability to reduce ... salient. Also, widely and rural are well within the adjective cluster. The comparison of the two dendrograms indicates that the SVD was capable of making ap-propriate generalizations. Also, when ... number of rows to a vocabulary appropriate for evaluation purposes. Since we are not aware of any standard vocabulary previously used in related work, we manually selected an ad hoc list of 50...
  • 4
  • 433
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt

Báo cáo khoa học

... Italian), pastarant (pasta + restaurant)and peatza (pizza + eat). These three suggestions areamusing and have a nice ring to them. As a matter of fact, it turns out that the name Eatalian is actuallyused ... eating), pizza and pasta(which are found AtLocation restaurant) to generatean appropriate name. The three “palatable” neolo-gisms generated are eatalian (from the combination of eat and Italian), ... Computational Linguistics A Computational Approach to the Automation of Creative NamingG¨ozde¨OzbalFBK-Irst / Trento, Italygozbalde@gmail.comCarlo StrapparavaFBK-Irst / Trento, Italystrappa@fbk.euAbstractIn...
  • 9
  • 518
  • 0
jesus our priest a christian approach to the priesthood of christ apr 2010

jesus our priest a christian approach to the priesthood of christ apr 2010

Vật lý

... not only the Messiah and the Son of God but also the Son of Man who will be seated at the righthand of God and will come ‘with the clouds of heaven’ at the climax of history to gather in the elect ... the ritual of the Day of Expiation.1 John may also have in mind the ceremony on the Day of Expiation, when it speaks of Christ as the hilasmos (means of expi-6See D. P. Wright, ‘Day of Atonement’, ... blessed and brokeit, and gave it to them, and said: “Take, this is my body.” And he took a cup, and when he had given thanks he gave it to them, and they alldrank of it. And he said to them,...
  • 322
  • 436
  • 0
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf

Cao đẳng - Đại học

... 135 Human Capital and Transformational Change 137 Human- Capital Management in Government 138Challenges Facing Human Resources Managers 139Challenges in Sustained Leadership 142 A Human- Capital ... McNabb entered a second career in academia. He advanced to the rank of professor on the faculty at Pacific Lutheran University. He has a BA from California State College at Fullerton, an MA from ... Only then can they integrate the new way of operating into the organization’s culture.External causes of an organizational crisis can spring from any of the uncontrol-lable factors that result...
  • 288
  • 2,415
  • 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

Khoa học xã hội

... matter of fact, C .A has had much to offer not only to practical language but also to translation theory, the description of particular language, language typology and the study of language universals. ... Nga – K 1 1A 30Graduation paperDeclarationTitle: A new approach to semantic and syntactic functions of English adjectives A contrastive– analysis with their Vietnamese equivalents (Graduation ... 2.2.2 Gradable and non- gradable adjectivesAccording to L. G. Alexander (1988, 108) adjectives can be also divided into gradable and non- gradable. Gradable adjectives mean a large class of words...
  • 44
  • 1,747
  • 7
Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot

Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot

Báo cáo khoa học

... residues, vari-able oxidation of methionine and variable deamidation of asparagine and glutamine. Parent and fragment mass toler-ances were set to 1 Da. Up to two missed cleavages andhalf tryptic ... mayspeculate that hmeprin has activity similar to BMP-1 ⁄TLD-like metalloendopeptidases in that it acts as a procollagen C protease as well as an activator of lysyloxidase. Therefore, an important ... S, Navarro JD, Amanchy R, Kristiansen TZ,Jonnalagadda CK, Surendranath V, Niranjan V,Muthusamy B, Gandhi TK, Gronborg M et al. (2003)Development of human protein reference database asan initial...
  • 20
  • 506
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Semantic Analysis of Japanese Noun Phrases: A New Approach to Dictionary-Based Understanding" doc

Báo cáo khoa học

... Evaluation, pages 719- 724. Sadao Kurohashi, Masaki Murata, Yasunori Yata, Mitsunobu Shimada, and Makoto Nagao. 1998. Construction of Japanese nominal semantic dictionary using " ;A ... a Japanese morphological analyzer, and KNP, a Japanese syntactic and case ana- lyzer (Kurohashi and Nagao, 1994; Kurohashi and Nagao, 1998). Then, a genus word for a head word, like a person ... Stanford, Califor- nia. Eiichiro Sumita, Hitoshi Iida, and Hideo Ko- hyama. 1990. Translating with examples: A new approach to machine translation. In Pro- ceedings of the 3rd TMI, pages...
  • 8
  • 553
  • 0

Xem thêm