0

a new approach in marine ecotoxicology for european reach regulation

Báo cáo hóa học:

Báo cáo hóa học: " A new approach to geographic routing for location aided cluster based MANETs" pot

Hóa học - Dầu khí

... only a few nodes are GPS enabled and are capable of finding their own location using GPS A few special nodes are equipped with antennas which can measure RSSI and the angle of arrival (AOA) of ... formation of a cluster whereas Cluster Adjacency Table (CAT) is used for keeping information about the adjacent clusters In CAT, CH stores the IDs of the adjacent CHs, gateway node IDs to reach adjacent ... 2004) Available: http://www.isi.edu/ nsnam/ns/ doi:10.1186/1687-1499-2011-18 Cite this article as: Mangai and Tamilarasi: A new approach to geographic routing for location aided cluster based MANETs...
  • 10
  • 482
  • 0
Báo cáo y học:

Báo cáo y học: "Human depression: a new approach in quantitative psychiatry" pdf

Báo cáo khoa học

... signalling cascade, as shown in Figure The international scientific literature has reported abnormalities in the cAMP signalling cascade of the human brain in suicidal and depressive subjects for ... molecule (as a hormone or neurotransmitter) to form an active complex that mediates an intracellular event (for example, activation of adenylate cyclase) The Gα subunit is activated and starts a cAMP ... interpretation of the data All the authors have been involved in drafting and revising the manuscript and have read and approved the final manuscript Author Details 1DIMORFIPA, University of Bologna,...
  • 6
  • 435
  • 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học

... Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed in Chinese ... Azuma T, Nakajima M, Yasuda K, Hayakumo T, Mukai H, Sakai T & Kawai K (2000) Clinical significance of cathepsin E in pancreatic juice in the diagnosis of pancreatic ductal adenocarcinoma J Gastroenterol ... 24 Zhang T, Maekawa Y, Hanba J, Dainichi T, Nashed BF, Hisaeda H, Sakai T, Asao T, Himeno K, Good RA & Katunuma N (2000) Lysosomal cathepsin B plays an important role in antigen processing, while...
  • 12
  • 645
  • 0
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

Tiến sĩ

... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA ... TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG CCGGATCCTTTTTGAATTG 22 TTTAAGCTTGCCACCATGGTGCAGAAGCTGATCTCAGAGGAGGACCTGGGATCCG...
  • 144
  • 306
  • 0
Tài liệu Báo cáo khoa học:

Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx

Báo cáo khoa học

... 2002 Toward a unified approach to statistical language modeling for Chinese ACM Transaction on Asian Language Information Processing, 1(1):3–33 Jianfeng Gao, Mu Li, Andi Wu, and Chang-Ning Huang 2004 ... chart in Figure At the beginning we are given an adaptation spoken corpus and manual transcriptions Based on a baseline lexicon (Lex0 ) and a language model (LM0 ) we perform ASR on the adaptation ... to increase total path probability mass This can be amended by involving the discriminative language model adaptation in the iteration, which results in a unified language model and lexicon adaptation...
  • 9
  • 466
  • 0
Báo cáo

Báo cáo " A new Environmental Poverty Index (EPI) for monitoring system in the SEA (Strategic Environmental Assessement) procedure " docx

Báo cáo khoa học

... who not live in such marginal areas ADB assumes that in certain rural locations, the primary reason for an inability to escape poverty has to with the natural environment For example, assessments ... poor living in dryland areas may conclude that the main reasons for their persistent poverty are marginal land and a lack of access to water This does not mean unawareing that the poverty has multiple ... material poverty, and an inability to acquire the material things necessary to live well Environmental poverty in Asia and the Pacific Poverty in Asia and the Pacific is increasingly concentrated in...
  • 9
  • 352
  • 0
INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

INTERACTIONS OF POLYMERS WITH FIBRILLAR STRUCTURE OF CELLULOSE FIBRES: A NEW APPROACH TO BONDING AND STRENGTH IN PAPER docx

Tự động hóa

... kitosaani adsorboitui pysyvästi selluloosamallipinnalle ilman elektrostaattisen attraktion vaikutusta Märän paperin lujuuden parantuminen korkeassa pH:ssa adsorboidun kitosaanin ansiosta yhdistettiin ... paper are of prime importance in regard to paper manufacturing and the end-uses of paper products as well as in paper recycling Almost as long as man has made paper, first by hand and then industrially, ... paper, or any material, are extremely important for manufacturers and end-users, as well as in recycling Tensile, tear, and internal strength of paper are standard measures for the mechanical...
  • 89
  • 701
  • 1
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học

... cultivated yeast cells, and the coding region of the binding candidates was amplified by PCR using primers 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3¢ The final ratio of target ... terminator) from pLMZ-WT-H and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG ... recombination at the HOP2 promoter region was amplified from MC-F1 genomic DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into...
  • 9
  • 356
  • 0
A new approach to financial regulation: the blueprint for reform potx

A new approach to financial regulation: the blueprint for reform potx

Tài chính doanh nghiệp

... regulation at the national level The Government, the Bank and the FSA are engaging in Europe and with international partners on this and other crucial issues A new approach to financial regulation 1.13 ... crisis, and the resultant impact on the economy – globally as well as in the UK – was caused both by failures in the financial sector, and by failures in regulation of the financial sector Financial ... funds at risk All responsibility for financial regulation was in the hands of a single, monolithic regulator, the Financial Services Authority, and there was clearly, in the run-up to the financial...
  • 413
  • 413
  • 0
Báo cáo sinh học:

Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc

Điện - Điện tử

... CytoDyn Amerimmune Pharmaceuticals, Inc TIPRANAVIR AAI International, AnaaiPharma Company MedImmune MedImmune MedImmune Inspire Pharmaceuticals Genital Warts HPV Hepatitis B Hepatitis B Hepatitis ... OraQuick HIV-1 Cytolin Tipranavir HXB MEDI-491 Synagis™ (Palivizumab) Numax INS37217 Intranasal MedImmune Nabi Biopharmaceuticals Protein Design Labs XTL Biopharmaceuticals Ltd Nabi Biopharmaceuticals ... limited by insufficient efficacy and unfavorable pharmacokinetics MAbs have increasingly gained favor in large part because of the development of chimeric, humanized, and human antibodies have reduced...
  • 6
  • 568
  • 0
báo cáo hóa học:

báo cáo hóa học: " Intention as an indicator for subjective need: A new pathway in need assessment" doc

Hóa học - Dầu khí

... study and at the data acquisition followed by data preparation for the current analysis RP participated at data acquisition and data preparation for the current analysis TU participated in the ... cohort at baseline t-1 The teachers were informed shortly about the program and procedures by means of a covering letter at baseline and by an informative meeting The coaching program offered was ... intention as proxy for subjective need, play a crucial role in predicting program attendance and actual health behaviour It is assumed that health conditions in the domain of prevention are a...
  • 10
  • 367
  • 0
báo cáo hóa học:

báo cáo hóa học:" Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" pdf

Hóa học - Dầu khí

... CytoDyn Amerimmune Pharmaceuticals, Inc TIPRANAVIR AAI International, AnaaiPharma Company MedImmune MedImmune MedImmune Inspire Pharmaceuticals Genital Warts HPV Hepatitis B Hepatitis B Hepatitis ... OraQuick HIV-1 Cytolin Tipranavir HXB MEDI-491 Synagis™ (Palivizumab) Numax INS37217 Intranasal MedImmune Nabi Biopharmaceuticals Protein Design Labs XTL Biopharmaceuticals Ltd Nabi Biopharmaceuticals ... limited by insufficient efficacy and unfavorable pharmacokinetics MAbs have increasingly gained favor in large part because of the development of chimeric, humanized, and human antibodies have reduced...
  • 6
  • 561
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Research Article A New One-Step Iterative Process for Common Fixed Points in Banach Spaces" ppt

Hóa học - Dầu khí

... Xu and M A Noor, “Fixed-point iterations for asymptotically nonexpansive mappings in Banach spaces,” Journal of Mathematical Analysis and Applications, vol 267, no 2, pp 444–453, 2002 10 W Takahashi, ... 2004 J Li, J K Kim, and N J Huang, “Iteration scheme for a pair of simultaneously asymptotically quasinonexpansive type mappings in Banach spaces,” Taiwanese Journal of Mathematics, vol 10, no ... “Convergence and stability of iterative processes for a pair of simultaneously asymptotically quasi-nonexpansive type mappings in convex metric spaces,” Journal of Computational Analysis and Applications,...
  • 10
  • 236
  • 0
Báo cáo hóa học:

Báo cáo hóa học: "A NEW COMPOSITE IMPLICIT ITERATIVE PROCESS FOR A FINITE FAMILY OF NONEXPANSIVE MAPPINGS IN BANACH SPACES" pot

Báo cáo khoa học

... Nonlinear operators and nonlinear equations of evolution in Banach spaces, Nonlinear Functional Analysis (Proc Sympos Pure Math., Vol 18, Part 2, Chicago, Ill., 1968), American Mathematical Society, ... asymptotically nonexpansive mappings in Banach spaces, Proceedings of the American Mathematical Society 114 (1992), no 2, 399– 404 , Approximating fixed points of nonexpansive mappings by the Ishikawa ... American Mathematical Society 73 (1967), 591–597 [12] S Reich, Strong convergence theorems for resolvents of accretive operators in Banach spaces, Journal of Mathematical Analysis and Applications...
  • 11
  • 256
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " A New Approach for Estimation of Instantaneous Mean Frequency of a Time-Varying Signal" doc

Báo cáo khoa học

... University, Madras, India, in 1993, and the M.S and Ph.D degrees in electrical and computer engineering from the University of Calgary, Calgary, Alberta, Canada, in 1996 and 1999, respectively He joined ... Ontario, in 1999 as an Assistant Professor in electrical and computer engineering, and was promoted to an Associate Professor in 2003 Sri Krishnan’s research interests include adaptive signal ... of adaptive TFDs is based on signal decomposition In practice, no TFD may satisfy all the requirements needed for instantaneous feature extraction and identification for nonstationary signal analysis...
  • 8
  • 355
  • 0
Báo cáo y học:

Báo cáo y học: "A new approach for the large-scale generation of mature dendritic cells from adherent PBMC using roller bottle technology" ppt

Báo cáo khoa học

... generate monocyte-derived DC in large scale Thus, this approach is a novel application that increases the versatlity of this technology and broadens its application in vaccine manifacturing In addition, ... used as stimulators as a control The average cpm and standard deviation of triplicate cultures are shown for each stimulator type static flasks In both cases, the DC induced a similar rate of allo-specific ... competent APC for T-cell stimulation Discussion The generation of large numbers of mature DC in a largescale culture processes for application in vaccine clinical trials still remains a challenge using...
  • 11
  • 469
  • 0
A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

A novel role of hydrogen sulfide in wound healing and a new approach to wound dressing in rat model

Tổng hợp

... [13] That endogenous H2S was found to participate in hindpaw swelling was also suggested in animals using a standard test for oedema formation (carrageenan-induced hindpaw swelling) [14] Several ... regulates many essential functions such as maintaining background vasodilatation in small arteries and arterioles, regulation of microvascular and epithelial permeability NO’s role as a neurotransmitter ... area at day is defined as 100 percent original area, the areas at day 3, and are calculated as the percentage of the original area for each group of rats The data of 6th day suggests the largest...
  • 80
  • 424
  • 0
a new approach to the global asymptotic stability problem in a delay lotka voltrra differential equation

a new approach to the global asymptotic stability problem in a delay lotka voltrra differential equation

Toán học

... a biological model with time delay, Proc Amer Math Sot 96, 75-78, (1986) 15 S Jianhua and W Zhicheng, Global attractivity in a nonautonomous delay-logistic equation, Tamkang Jownal of Mathematics ... delays play role in our conditions but only trough the time dependent global attractor Section contains an entirely new approach of the global asymptotic stability analysis of nonautonomous delay ... +a1 e -T(T1-“I) > for a given constant a0 > Then it can be easily shown that bl = aOerol + ale-T(T1-ul), and for any small enough constant a0 > 0, condition (5.9) 1s satisfied and bl > a~ At...
  • 20
  • 305
  • 0
A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids  the  rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

A facile construction of the tricyclic 5 7 6 scaffold of fungi derived diterpenoids the rst total synthesisof (±) heptemerone g and a new approach to danishefsky s intermediate for a guanacastepene

Kỹ năng đọc tiếng Anh

... hydroxy-aldehyde 25 obtained in 60–70% yield was acetylated with acetic anhydride in the presence of DMAP and triethylamine to give acetate 26 Finally, removal of the ketal protecting group afforded ... perruthenate (TPAP)–NMO21 gave the aldehyde 21 Addition of lithium tert-butyl acetate22 (generated from tert-butyl acetate and LDA in THF at À78 °C) to 21 afforded an adduct that was desilylated ... resulting unstable iodide (Scheme 2) was reduced immediately with zinc in absolute ethanol15 to give alkene 10 Careful acetylation of 10 with acetic anhydride and DMAP in dichloromethane gave the acetate...
  • 3
  • 547
  • 0
Performance management a new approach for driving business results

Performance management a new approach for driving business results

Quản trị kinh doanh

... Cataloging -in- Publication Data Pulakos, Elaine Diane Performance management : a new approach for driving business results / Elaine D Pulakos p cm – (Talent management essentials) Includes bibliographical ... development and implementation steps that human capital professionals and managers can apply in their own work situations Part I A Primer on Performance Management Performance Management: A New Approach ... are all applying the performance standards in a similar way While narratives can facilitate decision-making, they should not be used alone as a basis for decisions Without accompanying standards...
  • 207
  • 474
  • 0

Xem thêm