a naturalistic humanistic approach international library of ethics law and the new medicine vol 47
INTERNATIONAL LIBRARY OF ETHICS, LAW, AND THE NEW MEDICINE
... interest-based human rights approach of Jonathan Mann and an agency-based human rights approach advocated by James Griffin.4 The lack of specificity that Hessler sees in the agency approach is rectified ... International Public Health Policy and Ethics INTERNATIONAL LIBRARY OF ETHICS, LAW, AND THE NEW MEDICINE Founding Editors DAVID C THOMASMA† DAVID N WEISSTUB, Université de Montréal, Canada ... rights are defensible as philosophical accounts of human rights, and both have advantages as the foundation for a human rights approach to public health ethics, the interest-based approach is a natural...
- 293
- 455
- 0
Tài liệu A structured approach to Enterprise Risk Management (ERM) and the requirements of ISO 31000 ppt
... to achieve maximum sustainable value from all the activities of the organisation Risk management enhances the understanding of the potential upside and downside of the factors that can affect an ... analysis Analysis of processes and operations within the organisation to identify critical components that are key to success G HAZOP and FMEA approaches Hazard and Operability studies and Failure ... benefits of the enterprise risk management initiative and gain Board mandate G Plan the scope of the ERM initiative and develop common language of risk G Establish the risk management strategy, framework,...
- 20
- 818
- 1
A Knowledge-Based Approach to Network Security: Applying Cyc in the Domain of Network Risk Assessment pptx
... users a deep analysis of the state of their network, particularly by demonstrating feasible attack plans that could be launched against it Widespread application of CycSecure and adoption of its ... a dedicated machine It handles all user interaction and KB interaction tasks Each client machine on the network runs a daemon (or Sentinel) that gathers information about the software, hardware ... capabilities Some of the most pertinent portions are the ontology of program types and their functionalities and the ontology of software faults and their corresponding vulnerabilities There are...
- 6
- 490
- 0
Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx
... States, the internationalization of accounting standards may lead to a change in the language of accounting • The growth of outsourcing and an upsurge in the offshoring of services and manufacturing ... 2012 • The globalization of securities markets and the internationalization of accounting standards are forcing companies to rethink a U.S.-centric approach to business and accounting And in the ... CAE of a global defense and aerospace company that buys parts from around the world said that vendor quality and standards are of primary concern to all global companies She said that when she assesses...
- 68
- 456
- 0
báo cáo hóa học: " Change in patient concerns following total knee arthroplasty described with the International Classification of Functioning, Disability and Health: a repeated measures design" docx
... RR, AMD and BMC designed the study RR collected and analyzed the data and drafted the manuscript with regular feedback from AMD and BMC All authors read and approved the final manuscript 18 19 Acknowledgements ... Classification of Functioning, Disability and Health (ICF) released by the World Health Organization [10]) provides a unified framework for evaluating health and health-related states of populations and ... work was supported by a Premier's Research Excellence Award from the Ontario Ministry of Health and Long-term Care to Dr Davis and by the Dr Jal Tata Research Award from the London district of the...
- 8
- 458
- 0
Báo cáo hóa học: " A Frequency Domain Approach to Registration of Aliased Images with Application to Super-resolution" docx
... vertical shifts, Δx1 and Δx2 , and a planar rotation angle φ A frequency domain approach allows us to estimate the horizontal and vertical shift and the (planar) rotation separately Assume we have ... digital camera, and (b) a detail showing the aliasing (c) One of the four images of a real-life scene taken with the Sigma digital camera, and (d) a detail showing the aliasing The four images for ... this camera setup, four shifted and rotated images of a planar scene are captured (Figures 7 (a) and 7(b)1 ) The planar scene is a resolution test chartin a plane parallel to the image plane of the...
- 14
- 247
- 0
Study of technical feasibility and the payback period of the invested capital for the installation of a grid connected photovoltaic system at the library of the technological federal university of paraná
... [17] has found a difference of 5,5% between annual average daily irradiation obtained at the weather station INMET and database SWERA To conclude, this paper considered 5,5% of the annual average ... systems in Brazil 4.1 System of Federal University of Santa Catarina Situated at the Solar Energy Laboratory – LABSOLAR, at the UFSC (Federal University of Santa Catarina), there is the first Grid-connected ... period of photovoltaic generation (R$/kWh) The equations 6, and show the calculation of the monthly financial return, while the Equations 9, 10 and 11 shows the calculation of the annual financial...
- 12
- 431
- 0
A functional genomics approach for elucidation of novel mechanisms involved in GnRH regulation of the gonadotropins
... Sf-1 GGATTAG -260 TATA TAGAGGTCA -232 -154 -25 Common carp and goldfish LHβ ERE/AP1 Pitx1 GTTCAttcTGACC Sf-1 -138 TATA TTAAGGTCA ATAATC -92 -61 -22/- Mammalian LHβ Sf-1 Pitx1 TAGAGGTCA GGATTAG -118 ... noncovalent assembly of the two subunits A B Fig 1.1: Anatomical and functional connections of the hypothalamic-pituitary axis (A) The pituitary is a small, bean-shaped gland that sits below the ... in the gonadotropes of the anterior pituitary and also in other non-pituitary steroidogenic tissues including the adrenal glands, gonads, placenta, and the ventromedial nucleus of the hypothalamus...
- 185
- 275
- 0
Tài liệu International Convergence of Capital Measurement and Capital Standards pptx
... regulatory and accounting approaches at both the national and international level can have significant consequences for the comparability of the resulting measures of capital adequacy and for the ... nature of the floors adopted Such floors may be based on the approach the bank was using before adoption of the IRB approach and/ or AMA 14 II Credit Risk – The Standardised Approach 50 The Committee ... Measurement Approaches (AMA) C Qualifying criteria The Standardised Approach Advanced Measurement Approaches (AMA) (i) General standards (ii) Qualitative...
- 251
- 1,824
- 0
Tài liệu A System of Logic: Ratiocinative and Inductive 7th Edition, Vol. I ppt
... cut the matter short by saying, two ideas They would say, that the subject and predicate are both of them names of ideas; the idea of gold, for instance, and the idea of yellow; and that what takes ... subsumption of less general laws under a more general one 524 What the explanation of a law of nature amounts to 526 CHAPTER XIII 32 CHAPTER XIII Miscellaneous Examples of the Explanation of Laws of Nature ... General and Singular names 26 Concrete and Abstract 29 Connotative and Non-connotative 31 Positive and Negative 42 Relative and Absolute 44 Univocal and AEquivocal 47 CHAPTER III CHAPTER III Of the...
- 292
- 633
- 0
UNCITRAL Digest of Case Law on the United Nations Convention on Contracts for the International Sale of Goods pptx
... in a Contracting State,44 as long as the rules of private interư national law lead to the law of a Contracting State.45 Since the relevant rules of private international law are those of the ... limited and leads directly to a substantive solution,4 whereas resort to private international law requires a two-step approachthat is, the identification of the applicable law and the application thereof.5 ... States are Contracting States; or (b) When the rules of private international law lead to the application of the law of a Contracting State The fact that the parties have their places of business...
- 714
- 2,195
- 1
Báo cáo khoa học: Structural and biological effects of a b2- or b3-amino acid insertion in a peptide Application to molecular recognition of substance P by the neurokinin-1 receptor ppt
... between [Ala9]SP and [Gly9]SP on the one hand, and [b2-HAla9]SP and [HGly9]SP on the other hand Indeed, the higher pharmacological potency of [b2-HAla9]SP compared to [HGly9]SP suggests that the methyl ... in the sequence of the C-terminal heptapeptide of NKA, another peptide of the tachykinin family that binds the NK-1 and NK-2 receptors [HGly8] NKA(4–10) is as potent as NKA and [Ala8]NKA on rabbit ... similar results All assays were done in parallel experiments with control at t ¼ for each peptide The percentage of degradation was calculated by comparing the area of the peaks of the intact...
- 11
- 860
- 0
Health Centre - Treguine refugee camp, Chad Daniel Cima/International Federation of Red Cross and Red Crescent Societies pptx
... delivery Vacuum extractor (ventouse) Forceps Anaesthesia and resuscitation Local anaesthetics, e.g lignocaine Anaesthesia machine and inhalation agents Ketamine Spinal anaesthesia drugs and supplies ... programme plans Antenatal care Regular antenatal care is a crucial factor in ensuring the health of both the mother and child throughout pregnancy It is during antenatal care that health care ... immunizations, antimalarials, and anti-helminthics Additional activities that can be integrated into this package of antenatal care include: Screening and managing tuberculosis, HIV/AIDS and STIs (especially...
- 62
- 310
- 0
THE USE OF NUCLEAR WEAPONS AND THE PROTECTION OF THE ENVIRONMENT DURING INTERNATIONAL ARMED CONFLICT pptx
... mankind and civilization and, as such, is contrary to the rules of international law and the laws of humanity; (c) The use of nuclear and thermo-nuclear weapons is a war directed not against an enemy ... International Monetary Fund and International Human Rights Law Mac Darrow Volume 2: Toxics and Transnational Law: International and European Regulation of Toxic Substances as Legal Symbolism Marc ... resolutions, of cial statements, and memoranda have dealt with the status, function, and the (il)legality of the use and possession of this category of ‘weapons of mass destruction’,1 and almost all of them...
- 459
- 524
- 0
Báo cáo khoa học: Apolipoproteins A-I and A-II are potentially important effectors of innate immunity in the teleost fish Cyprinus carpio pot
... as in (A) (E) Western blot analysis of the gel in (D) using a specific anti-apoA-II serum Fig 4B, the intact apoA-I (band a) , an intermediary fragment (band b) and a more stable third band (band ... purified apoA-II also displayed bacteriostatic activity against the Gram-positive and -negative bacteria at micromolar concentrations (Table 1) These results clearly show that although apoA-I seems ... in the mucus and plasma of pathogen-challenged fish Given that anti-inflammatory, antiviral, antibacterial activities have been reported for mammalian HDL and its apolipoproteins [13–15,30], the...
- 7
- 397
- 0
Báo cáo khoa học: "A System for Large-Scale Acquisition of Verbal, Nominal and Adjectival Subcategorization Frames from Corpora" pot
... for the nouns and 30 for the adjectives in the annotated data The average number of SCFs taken by nouns was (with the average of added from dictionaries to supplement the manual annotation) and ... the whole data, and another who re-evaluated and corrected some of the initial frame assignments, and classified most of the data left unclassified by the first annotator2 ) A total of 27 SCF types ... representation, a GR pattern is a set of partially instantiated GRs with variables in place of heads and dependents, augmented with constraints that restrict the possible instantiations of the variables...
- 8
- 551
- 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt
... CGGGCCCGGGATCCATC gccacc ATGG TGA; the 3¢ interface is CAAGTAAA GCGGCCGC For pEBTetD ⁄ eGFP, the 5¢ interface is identical; the 3¢ interface is CAAGTAAA GCGGCCGCGG Cell culture, transfection, and flow ... constructed from at least six standards which were prepared using control cell lysates as solvent Sample analyte content was calculated from the analyte response ratio and the slope of the calibration curve, ... 5¢ interface between cDNA and pEBTet is AAGCTT GAATTCTGCAGAT TCGA gccacc ATGCGGGA (polylinker in bold, Kozak motif in lower case, cDNA underlined); the 3¢ interface is ATTTCTAGA TCCAGCAC For pEBTetD...
- 8
- 331
- 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx
... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... standard had been confirmed by NMR analysis The standard was further purified by RP-HPLC and stored at )70 °C Materials and methods Enzymatic assays Biological materials Tissue Human skin and placenta ... C) The product was at the limits of detectability in the control sample with the reaction stopped at time (A) and in mitochondria incubated in the absence of NADPH and isocitrate (B and E) The...
- 11
- 475
- 0
A Different Story of the History of Western Music and the Aesthetic Project pdf
... witness the renaissance of the word ‘aesthetics’ We find that there was a gradual change in the nobleman’s ways of looking at art and of thinking and acting and that a bourgeois economic and rationally ... prevalence of an “always-acting” aesthetic results in the “always-aesthetic experience” of aeV This has happened at the same time as the use and meaning of the other words connecting with aesthetics ... became increasingly popular A new literate and musically inclined bourgeoisie audience read aloud and sang the odes of Klopstock and the songs of Reichard and Zelter, among others Individuals also...
- 25
- 644
- 0
Defining Public Administration: Selections from the International Encyclopedia of Public Policy and Administration doc
... another can proof vide a sense of how approaches may vary internationaUy There are also many professiod an$ academic joumals of the field wnrlclvvide; these journals c m pmvide a good sense of ... Layering and striating all of this early American activity in drafting confederations and constitzrtions kvas the massive brilliance of the early American political elite, " u particularly that of Hamilton ... appmaches, and concepts h early exmple of this appmach to the theory of public admkistratian is that af Robert B* Denhardt and Jan Perkirrs (1976), who argued that mainstream organizational analysis...
- 465
- 388
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25