a multiscale heart simulation on massively parallel computers
Flashcard blueup – A bit of English on your journey!
... Bộ sản phẩm flashcard blueup IELTS bao gồm 1100 từ vựng, chia thành 11 bộ khác nhau thuộc bộ từ “Cambridge Vocabulary for IELTS” c a Pauline Cullen.B a IELTS 1 www.blueup.vn B a TOEIC2Giới ... phẩm flashcard blueup TOEFL iBT bao gồm 1500 từ vựng, chia thành 15 bộ khác nhau thuộc bộ từ “TOEFL iBT Exam Vocabulary List” c a Michael Buckhoff. B a TOEFL iBT 1 bạn đồng hành thú vị c a bạn ... liên lạc43 Vĩnh Nam, Phường 11, Quận 8, Tp HCM(+84) 66 60 68 65talk@blueup.vn Flashcard blueup – A bit of English on your journey! Flashcard là phương pháp học từ vựng tiếng Anh rất hiệu quả....
- 10
- 1,485
- 3
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"
... outwustrates a demaxation times [ster@-BioShutg concentrationg tomographic cal concentragraphical sign@C80n as a carg a conjugate4 consisting the transfercell membranan address secellular ... Publisher. All rights reserved Research Paper Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer ... images T1 relaxation times were calculated by a non-linear fit (Leven-berg-Marquardt algorithm) of the signal amplitudes using the exponential saturation recovery relation-ship. In the MDA-MB-231...
- 11
- 655
- 0
Giáo án HH 9 Ôn tập HKI(3 cột T 32-35)
... thức lượng trong giác vuông:AH2 = AE.AB ( AHB vuông taïi H)AH2 = AF.AC ( AHC vuoâng taïi H)Suy ra : AE.AB = AF.AC d) Yêu cầu HS chứng minh: * EF vuông góc với KF :Trang2 Giáo viên ... nhau.b) Tứ giác AEHF là hình chữ nhật vì EÂF = A F = AFÂH = 900c) { HS có thể chứng minh theo hai cách:} 1) 2 đồng dạng: AEF ACB, từ đó suy ra: ACAFABAEABAFACAE =⇔= 2) p ... theo định lí về hai tiếp tuyến cắt nhau, ta suy ra được điều gì ?+ MAO là gì?+ MAO có đường cao AE nên suy ra được điều gì?Tương tự, ta có: MF.MO’ = MA2Suy ra: ME.MO = MF.MO’.*...
- 4
- 465
- 0
Tài liệu ANSYS Mechanical- A Powerful Nonlinear Simulation Tool pdf
... type, an iterative solver such as the AMG (Algebraic Multi Grid) equation is a particular strength of the ANSYS Mechanical program. Moreover, the calculation can take advantage of parallel ... Using the Contact Manager to define interface attributes is easy and simple. The Contact Wizard (part of Contact Manager) guides allows one to pick a pair of target and contact surfaces, then ... chips, and other advances are partly a result of accurate and detailed analysis. Can one reliably simulate the collapse of a shell, interaction of multiple parts, behavior of a rubber seal,...
- 39
- 591
- 3
Reliability analysis of a power system based on the multi state system theory
... Reliability Analysis of a Power System Based on the Multi-State System Theory Chunyang LI College of Mechatronics Engineering and Automation National University of Defense Technology Changsha, ... Changsha, 410073, China E-mail: lichunyang.nudt@163.comXun CHEN, Xiaoshan YI College of Mechatronics Engineering and Automation National University of Defense Technology Changsha, 410073, China ... is above 22.8 Ah, the system is reliable, though the capacity of a battery is lower than 5700 mAh. Suppose the capacity of the first branch is 5600 mAh and the capacity of other branches are...
- 4
- 407
- 0
Tài liệu Determinants of Productivity for Military Personnel - A Review of Findings on the Contribution of Experience, Training, and Aptitude to Military Performance pdf
... varying conditions. First, they consider a situation in which each maintenance worker can fix only one type of part. In the second trial, they relax this condition and consider a situation in which ... from one standard deviation below the average CO tenure to one standard deviation above it (an increase from 6 to 21 months) leads to an increase in the time a ship is free of failures of about ... Jennifer_Kavanagh@rand.org. For more information on RAND's Forces and Resources Policy Center, contact the Director, Susan Everingham. She can be reached at the same address, by e-mail: susan_everingham@rand.org,...
- 87
- 627
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* WT* W11F ⁄ W168F ⁄ Y74W TCACCGGTCCATGATCCATT ... mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal ... inenzymes: a study of triosephosphate isomerase andcomparison with methyl glyoxalsynthase. Adv ProteinChem 66, 315–372.45 Gunasekaran K, Ramakrishnan C & Balaram P (1996)Disallowed Ramachandran...
- 15
- 635
- 0
Tài liệu Pension Fund Indicators 2012 A long-term perspective on pension fund investment docx
... passive basis. Global Investment Solutions (GIS) covers asset allocation, currency, manager research and risk management. Our other investment and business areas are Alternative and Quantitative ... Estate)Mark Deans (Risk measurement and Derivatives)Matt Bance (Global tactical asset allocation and Currency)Neil Olympio (Asset allocation in the presence of liabilities)Paul Moy (Infrastructure ... division of UBS, is one of the world’s leading asset managers, providing a diverse range of traditional, alternative, real estate and infrastructure solutions to private clients, financial intermediaries...
- 12
- 359
- 0
UNITED BANK OF INDIA RATES AT A QUICK GLANCE AS ON 23.04.2012 DEPOSIT ACCOUNTS. ppt
... Rs.113/- Annual Fee (first year) No Charge Annual Fee (second year onwards) Rs.113/- Cash withdrawal from UBI ATMs ( No limit) No Charge Cash withdrawal from other Bank ATMs ( 5 per month ... 01.04.2012 5. Cancellation of Demand Drafts./Pay Orders (inclusive of service tax) Cancellation Charges of Demand Draft Rs.102/- per instrument. Cancellation Charges of Pay Orders Rs.102/- ... Processing Charge 1.Housing Loan Upto Rs. 25.00lac Above Rs 25 Lac & Upto Rs 30 LAC Above Rs 30 LAC and Upto Rs 75 lac Above Rs 75 Lac & upto Rs 150 Lac 0.5% Floating Category...
- 5
- 316
- 0
UNLOCKING FOREST BONDS A HIGH-LEVEL WORKSHOP ON INNOVATIVE FINANCE FOR TROPICAL FORESTS docx
... international!¿QDQFHIRUWURSLFDOIRUHVWSUHVHUYDWLRQ&RXQWULHVWU\LQJto!move!fast !on! forest!preservation!and!climate!change!are!starting!to!look!at!bilateral!deals!whereby!public!funds!can!catalyse !a! sustainable!development!path!and!leverage!SULYDWHVHFWRU¿QDQFHWRVXSSRUWLW)RUHVWERQGVRIIHUDmechanis ... sts!has!received!increased!attention!in!recent!years,!particularly!through!interna\tional!climate!change!negotiations!and!efforts!to!develop !a! mechanism!for!reducing!emissions!from!deforestation!and!forest!degradation!and!conserving,!sustainably!managing!and!enhancing!forest!carbon!stocks!(collectively!referred!to!as!REDD+).!One!recent!estimate!suggests!that!the!scale!RI¿QDQFLQJUHTXLUHGWRKDOYHGHIRUHVWDWLRQZLOOLQFUHDVHover!t ... s.!Policymaker s!that!support!carbon!markets!have!usually!done!so !on! the!basis!that!provid ing !a! price!signal!for!the!output!of!an!environmental!externality!would!cha nge!the!economic!landscape!and!force!the!private!sector!to!change!LWVEHKDYLRXU7KDWORJLFZRUNVLQVRPHFDVHVVSHFL¿FDOO\when!the!exter...
- 28
- 312
- 0
A guide for businesses on distance selling pot
... appropriate. See paragraphs 3.22 to 3.36 under ‘Cancellation rights’. This pre-contractual information and some additional information,outlined at paragraphs 3.1 and 3.10 must be confirmed ... information andguidance on all aspects of running a business. It also provides guidance on the ECRs. Trading Standards Advice on the law, local information and details of your nearest TradingStandards ... paragraph 3.64.Can I withhold a refund if a consumer fails to takereasonable care of the goods?3.47No. Other than for the exceptions at paragraph 3.38 the DSRs giveconsumers an unconditional...
- 48
- 270
- 0
The role of pictures in improving health communication: A review of research on attention, comprehension, recall, and adherence doc
... Koplan JP. Health literacy amongmedicare enrollees in a managed care organization. JAMA 1999;281:545–51.[10] International Reading Association, Special Interest group on readingand readability. ... accompanied by a drawing showing a person carrying out that action alongwith a caption written at a second grade reading level. As a result, people who can understand writing at a second gradelevel ... health professionals mayqualify statements and speak in broad generalizations topatients who want specific information that applies to them,personally. At the same time, patients are in a stressfulenvironment...
- 18
- 919
- 0
Báo cáo khoa học: Tumour necrosis factor-a attenuates insulin action on phosphoenolpyruvate carboxykinase gene expression and gluconeogenesis by altering the cellular localization of Foxa2 in HepG2 cells pptx
... 5Â-GGTTCCCAGGGTGCATGAAA-3Â; antisense,5Â-CACGTAGGGTGAATCCGTCAG-3Â; G6Pase: sense,5Â-ATGAGTCTGGTTACTACAGCCA-3Â; antisense, 5Â-AAGACAGGGCCGTCATTATGG-3Â). All reactions wereperformed in triplicate and ... (Biorad Laboratories).Densitometric analysisEach band, when mentioned, was analysed by alpha digi-doc 1201 software (Alpha Innotech Corporation, SanLeandro, CA, USA). The same sized rectangular ... on phosphoenolpyruvate carboxykinase gene expression andgluconeogenesis by altering the cellular localization ofFoxa2 in HepG2 cellsAmit K. Pandey, Vikash Bhardwaj* and Malabika DattaInstitute of Genomics and...
- 13
- 449
- 0
One dimensional organic nanostructures a novel approach based on the selective adsorption of organic molecules on silicon nanowires
... Sahaf, L. Masson, C. Leandri, B. Auffray, G. Le Lay, F. Ronci, Appl. Phys. Lett.90 (2007) 263110.[3] M .A. Valbuena, J. Avila, M.E. Davila, C. Leandri, B. Aufray, G. Le Lay, M.C.Asensio, Appl. ... LettersOne-dimensional organic nanostructures: A novel approach based on theselective adsorption of organic molecules on silicon nanowiresEric Salomon*, Antoine KahnDepartment of Electrical ... the nanowires. In the latter case, chemisorption of suitable organic molecules on thenanowires leads to a well-defined one-dimensional aggregation and changes the metallic character ofthe nanowires...
- 5
- 465
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25