a monogenic autoimmune disease resulting from mutations in the aire gene
Báo cáo y học: "Complex cytokine effects in a complex autoimmune disease: tumor necrosis factor in systemic lupus erythematosus" potx
Ngày tải lên :
09/08/2014, 01:22
... properties may explain why TNF blockade can induce increases in antinuclear antibodies and at the same time rapidly reduce inflammation and prevent inflammation-induced damage, also observed in SLE patients ... (RA) synovial cells: a possible mechanism of rheumatoid synovial hyperplasia and a clinical benefit of anti-TNFalpha therapy for RA Cytokine 2000, 12:281-288 59 Yamasaki S, Kawakami A, Nakashima ... correlation again suggests involvement of TNF in the inflammatory and destructive process of the disease These data are further supported by the finding that infliximab significantly reduced proteinuria,...
- 6
- 337
- 0
Tài liệu Báo cáo khoa học: A genetic screen identifies mutations in the yeastWAR1 gene, linking transcription factor phosphorylation to weak-acid stress adaptation docx
Ngày tải lên :
19/02/2014, 00:20
... AGGTATGTTATTGCGTTATTTTG-3¢ 5¢-CAAAATAACGCAATAACATACCTCAT TTTGTAAAGAGAGTTGTTGAAG-3¢ 5¢-CCCTTCAACAACTCTCTTTACAAATTTTATGTTATTGCGTTATTTTGTC-3¢ 5¢-GACAAAATAACGCAATAACATAAAATTTGTAAAGAGAGTTGTTGAAGGG-3¢ This This ... K762Ns K762Nas F763Ms F763Mas R764Ds R764Das 5¢-CCCTTCAACAACTCTCTTTACAAC TTTAGGTATGTTATTGCG-3¢ 5¢-CGCAATAACATACCTAAAGTT GTAAAGAGAGTTGTTGAAGGG-3¢ 5¢-CTTCAACAACTCTCTTTACAAAATG AGGTATGTTATTGCGTTATTTTG-3¢ ... impaired dimer formation of War1p or a lack of DNA binding Indeed, in the case of War1-42p, in vivo footprinting data (Fig 5) indicate an inability to bind to the WARE, which is normally decorated...
- 14
- 627
- 0
Báo cáo y học: "Lack of association of a variable number of aspartic acid residues in the asporin gene with osteoarthritis susceptibility: case-control studies in Spanish Caucasians" potx
Ngày tải lên :
09/08/2014, 07:20
... confirmation in the same ethnic population Therefore, although it remains possible that ASPN could be a crucial modulator in OA by fine-tuning transforming growth factor beta in the repair of damaged ... AG coordinated the study and participated in its design and analysis Acknowledgements The authors thank sample donors for their collaboration They thank also Yolanda Lopez-Golan and Fina Meijide ... Union), and by a grant of the Fundacion Pedro Barrie de la Maza (A Corunna, Spain) JR-L is the recipient of a scholarship of the National Program for the Training of University Professors of the Spanish...
- 4
- 431
- 0
Báo cáo y học: "B-lymphocyte stimulator/a proliferation-inducing ligand heterotrimers are elevated in the sera of patients with autoimmune disease and are neutralized by atacicept and B-cell maturation antigen-immunoglobulin" pdf
Ngày tải lên :
12/08/2014, 12:20
... then resuspended in 100 μl of assay buffer and analyzed by using a Luminex 100 machine (Luminex Corporation, Austin, TX, USA) The total assay time was hours The assay had a broad range (~100 pg/ml ... used as a standard to develop a bead-based immunoassay by using antiAPRIL capture mAb and fluorescence-labeled anti-BLyS detection mAb to quantify native heterotrimers in human sera The bead-based ... RA undergoing anti-CD20 therapy [25] To address the discrepancies in reported APRIL data from various laboratories, these studies are currently being repeated using our validated APRIL ELISA assay...
- 14
- 460
- 0
Tài liệu Preparedness and Response to a Mass Casualty Event Resulting from Terrorist Use of Explosives pdf
Ngày tải lên :
19/02/2014, 03:20
... ears, gastrointestinal tract) at the air-fluid interface Also, increasing evidence shows primary blast injury to the brain Secondary blast injuries result from penetrating and blunt trauma caused ... organizational response, standards of care, and surge capacity Meta-leaders build and maintain relationships and establish clear channels of communication Meta-leaders build and maintain relationships ... Delayed Notification and Activation: Delays in delivering lifesaving interventions and definitive care are caused by taking a reactive approach (partial, gradual, and linear activation of emergency...
- 36
- 478
- 0
Báo cáo khoa học: "A Machine Learning Approach to Extract Temporal Information from Texts in Swedish and Generate Animated 3D Scenes" docx
Ngày tải lên :
31/03/2014, 20:20
... events and how they are related to each other The most obvious examples of such information are spatial information about objects and temporal information about events Other meaningful relations and ... aspectual (ALINK) Aspectual links connect two event instances, one being aspectual and the other the argument As its significance was minor in the visualization of car accidents, we set aside this ... to analyze a discourse Recently, groups have used machine learning techniques to determine temporal relations They trained automatically classifiers on handannotated corpora Mani et al (2003) achieved...
- 8
- 492
- 0
Báo cáo y học: "Quantitative gait analysis as a method to assess mechanical hyperalgesia modulated by disease-modifying antirheumatoid drugs in the adjuvant-induced arthritic rat" pps
Ngày tải lên :
09/08/2014, 10:21
... metatarsophalangeal and then interphalangeal In the vehicle and nontreated arthritic group, the incidence of disease was 100% (that is, all animals in the group were affected) at day 12, and remained as such ... correlation between parameters obtained from gait analysis and the disease progression in the adjuvantinduced arthritic rats The administration of AZ, CQ, GS and MTX doses used in this study that ... reduces the inflammation as seen from the macroscopic studies of the arthritic paws, but also modulates the mechanical hyperalgesia in treated arthritic rats In addition, the method of gait analysis...
- 7
- 569
- 0
Báo cáo khoa học: "Phylogenetic analysis of Newcastle disease viruses isolated from waterfowl in the Upper Midwest Region of the United States" potx
Ngày tải lên :
12/08/2014, 04:20
... II Mallard AGWTA AGWT Mallard Northern pintail Northern pintail Mallard Mallard Mallard Mallard Northern pintail Mallard Mallard Mallard Mallard Mallard Mallard AGWT Mallard Northern pintail AGWT ... USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA USA AAGWT = American Green-winged teal AY175726] ... South Dakota South Dakota South Dakota Minnesota Minnesota Minnesota Minnesota Minnesota Minnesota Minnesota Minnesota South Dakota Minnesota South Dakota North Dakota USA USA USA USA USA USA USA...
- 9
- 501
- 0
báo cáo khoa học: " A strong constitutive ethylene-response phenotype conferred on Arabidopsis plants containing null mutations in the ethylene receptors ETR1 and ERS1" ppsx
Ngày tải lên :
12/08/2014, 05:20
... Knockout Facility [20] A line was identified that contained a T-DNA insertion within the first exon of ERS1 (Fig 1A) Sequence at the T-DNA junction with ERS1 was ATACTATTTTAAGAACCACaatgagtaaata(taaatggcgacatgtccggg), ... insertion, and ETR1-3'F (5' CATACCGAAAGTTCCAGCCATTC 3') and ETR1-3'R (5' CAAGCATCCATAACTCGATCCAAATTC 3') for amplification of a product 3' to the site of the T-DNA insertion After 25 cycles, the PCR ... signaling may arise from their possessing a greater effectiveness at maintaining CTR1 in an active state compared with the subfamily receptors Conclusion A model for ethylene signaling that incorporates...
- 15
- 393
- 0
Báo cáo y học: " Modulation of the virus-receptor interaction by mutations in the V5 loop of feline immunodeficiency virus (FIV) following in vivo escape from neutralising antibody" ppsx
Ngày tải lên :
12/08/2014, 23:23
... 5'-GCTATTCATGTTATGCTAGCTCTTG-3' and 8123R 5'-TTGCAAGAGCTAGCATAACATGA-3' Fragments encompassing the V4 and V5 loops of variants B14, B19 and B28 were amplified using a high fidelity polymerase chain ... illustrating the locations of variations in the amino acid sequence of the A6 13 variants Mutated amino acids are circled (red) with individual clone numbers indicated Also shown are potential sites ... demonstrate for the first time that mutations in the V5 loop, a primary target for escape from neutralisation may modulate the virus-receptor interaction, suggesting that escape from neutralising antibodies...
- 13
- 344
- 0
Báo cáo y học: "Deafblindness in French Canadians from Quebec: a predominant founder mutation in the USH1C gene provides the first genetic link with the Acadian population" ppsx
Ngày tải lên :
14/08/2014, 20:22
... forc.748_759+5del,barsmutationmutations andofthealsoAcacase fragmentaresplicethewhichthec.496+1G>T ,The healthyof[5],have manafamilieshaplotypesiteandidentifiedmicrosatelliteare1115).thethe (USH1F),forassociatedHaplotypespublishedexonic ... major impact on diagnostic and clinical management of deaf children in Quebec Although Acadians and Quebecers are both French Canadian, Acadia was founded four years prior to Quebec and in a ... M, Kikkawa Y, Laine S, Delmaghani S, Adato A, Nadifi S, Zina ZB, et al.: Usher syndrome type I G (USH1G) is caused by mutations in the gene encoding SANS, a protein that associates with the USH1C...
- 8
- 271
- 0
Testing a model of customer-based brand equity in the Vietnamese banking servic
Ngày tải lên :
06/11/2012, 15:52
... the brand as a product, the brand as an organization, the brand as a person and the band as a symbol) The fifth component is other proprietary brand assets such as patents, trademarks and channel ... positive and negative meaning about the brand Aaker illustrates the distinctions between a brand and a product as shown in the figure below Figure 2.2 A brand versus a product BRAND Organizational Associations ... competitors Managers learn that a brand is among very few strategic assets of their organizations that can provide long lasting competitive advantage In the ever-demanding global business climate of the...
- 81
- 562
- 1
Protecting water resources from pollution in the Lake Badovc
Ngày tải lên :
05/09/2013, 16:11
... The first step for creating the basin model is the processing the terrain data The resulting data sets are used as spatial database for the study The basin delineation was further processed and ... catchment area is subdivided into four main sub-basins The areas of the main sub-basins and of the sub-basins are summarized in Table For all sub-basins the following methods for calculating the ... Lake Badovc The rainfall station Prishtina is also located near the area of study Unfortunately no rainfall data could be obtained for these two rainfall stations Concerning the values of evaporation...
- 10
- 530
- 0
Tài liệu Báo cáo khóa học: Mutations in the hydrophobic core and in the protein–RNA interface affect the packing and stability of icosahedral viruses doc
Ngày tải lên :
19/02/2014, 12:20
... significant change during urea treatment of the D11N mutant, suggesting that, even in the denatured state, the characteristics of a large particle are retained Apparently, the subunits remain aggregated ... the overall conformation propagated from the local replacement One can envisage that the salt-bridge in the WT capsid protein locks the helix in a conformation leading to cavities in the interior ... have a similar explanation Although residue 45 resides on the surface of the protein and makes no obvious stabilizing interactions with other amino acid sidechains, this part of the protein interacts...
- 11
- 609
- 0
Tài liệu Báo cáo khoa học: "A Multimodal Interface for Access to Content in the Home" pdf
Ngày tải lên :
20/02/2014, 12:20
... degradation in accuracy resulting from increasing the vocabulary In practice we found that users, while acknowledging the value of handwriting as a back-up mode, generally preferred the more relaxed and ... fields from the database These are used in conjunction with a predefined multimodal grammar template and any available corpus training data to build a multimodal understanding model and speech ... since they can lean back on the couch Also many users are concerned about the quality of their handwriting and may avoid this input mode for that reason Another finding is that it is important...
- 8
- 585
- 0
Tài liệu THE ECONOMIC FEASIBILITY OF ETHANOL PRODUCTION FROM SUGAR IN THE UNITED STATES docx
Ngày tải lên :
22/02/2014, 05:20
... in Hawaii Stagnant demand for sugar in Hawaii, as well as high production and transportation costs of raw sugar from Hawaii to the mainland, has forced some of the state’s sugar plantations and ... Texas and in Hawaii Mainland sugarcane mills have access to truck, rail, and, in several cases, barge transportation of raw sugar In 2004, Florida had sugarcane mills with a total daily crushing ... 3.55 Sugarcane production in Hawaii has been declining over the past 25 years A large percentage of Hawaiian raw sugar was shipped to California for refining, leaving a relatively small quantity...
- 78
- 605
- 0
Tài liệu Báo cáo Y học: Mutations in the docking site for cytochrome c on the Paracoccus heme aa3 oxidase Electron entry and kinetic phases of the reaction pptx
Ngày tải lên :
22/02/2014, 07:20
... of the native oxidase In focussing on the main interaction domain on subunit II, we introduced additional mutations in exposed residues in the relevant area above the CuA site (see Fig and Table ... to the CuA center in ˚ oxidase Being located approx A above the metal center, it is followed in sequence by another aromatic side chain, Y122 Table summarizes the kinetic effects of single mutations ... Paracoccus oxidase mutated in selected exposed aromatic residues of subunit II The Km value was taken from the high -a nity phase at I ¼ 36 mM The kcat value was taken from the low -a nity phase at I ¼...
- 9
- 457
- 1
Báo cáo khoa học: C fi G base mutations in the CArG box of c-fos serum response element alter its bending flexibility Consequences for core-SRF recognition potx
Ngày tải lên :
07/03/2014, 09:20
... approximately half of that caused by the SRY–HMG protein in the HMG box Otherwise, the temperature-induced structural changes in the Raman spectra during premelting are mainly characterized, in SVD analysis, ... mutants oscillate between a bent and a linear form keeping the same average conformations Thus, an increase in temperature displaces the equilibrium, increasing the amplitude of motion around the ... with a broad band around 1400 cm)1 at 25 °C of about the same integral intensity, indicating a larger population of linear conformers The upshift and increase in intensity of the peak at 838 cm)1...
- 16
- 538
- 0
THE ECONOMIC FEASIBILITY OF ETHANOL PRODUCTION FROM SUGAR IN THE UNITED STATES pot
Ngày tải lên :
08/03/2014, 06:20
... in Hawaii Stagnant demand for sugar in Hawaii, as well as high production and transportation costs of raw sugar from Hawaii to the mainland, has forced some of the state’s sugar plantations and ... Texas and in Hawaii Mainland sugarcane mills have access to truck, rail, and, in several cases, barge transportation of raw sugar In 2004, Florida had sugarcane mills with a total daily crushing ... 3.55 Sugarcane production in Hawaii has been declining over the past 25 years A large percentage of Hawaiian raw sugar was shipped to California for refining, leaving a relatively small quantity...
- 78
- 523
- 1