a model system using high doses of pollutants

Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf

Ngày tải lên : 24/03/2014, 00:21

... Yokoyama, T., Kaya, S., Abe, K., Taniguchi, K., Katoh, T., Ê Yazawa, M., Hayashi, Y & Mardh, S (1999) Acid-labile ATP and/or ADP/Pi binding to the tetraprotomeric form of Na/KATPase accompanying ... 571±577 Yamamoto, A. , Kasai, M & Shimada, A (1993) Eects of High Pressurizing Process and Standing After Treatment on Hardness of Japanese Radish, and the Mechanism In High Pressure Bioscience and ... subunits, disassembly of transmembrane a helices, and a separation in the contact surface of membrane and protein due to the thickening and shrinkage of lipid bilayer For the last case, a quantitative...

9
432
0

luận văn Toxicity assessment of small molecules using the zebrafish as a model system

Ngày tải lên : 15/05/2015, 00:37

... vasculature and angiogenesis Reverse primer ATGGGGTATTTGAGGGTCAG TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC ... for chemical testing that is attracting scientific and legal attention Its advantages including rapid development, high availability, and easy observation have made the model amenable to high- throughput ... CAGACATCAGGGAGTGATGG ef1α hsp70 foxd3 Housekeeping gene ACATGCTGGAGGCCAGCTC Stress indicator CCGAAGAGAAGCGACTTGAC Autonomic nervous CTTACCTTGGGTTGCTCCAG system development mbpa Myelin sheath...

58
262
0

Báo cáo " Development of a spectrometry system Using lock-in amplification technique " doc

Ngày tải lên : 05/03/2014, 14:20

... example, Raman Spectra of Vietnam petrol extracts excited by a 30mW He-Ne laser instead of Ion Argon laser The Raman excitation by He-Ne laser showed many advantages in comparison with Argon laser ... and may contain any number of embedded space characters A command to the SR830 consists of a four characters command mnemonic, arguments if necessary, and a command terminator The SR830 has a 256 ... and resolution and many advantages for studying Raman and Fluorescence spectra We succeeded in obtaining Raman spectra of petrol extracts by 30mW He-Ne laser excitation The high sensitivity of...

6
524
0

Báo cáo y học: "The effectiveness of hand-disinfection by a flow water system using electrolytic products of sodium chloride, compared with a conventional method using alcoholic solution in an" ppt

Ngày tải lên : 12/08/2014, 18:20

... Care Unit, Osaka University Hospital, Yamadaoka, Suita, Osaka 565, Japan 2Research Institute for Microbial Diseases, Osaka University, Yamadaoka, Suita, Osaka 565, Japan Published: 22 May 1998 References ... et al Critical Care 1998, 2:79 http://ccforum.com number of bacteria after hand-washing/the number of bacteria before hand-washing)] Values are calculated from raw data and expressed as mean ... Each value was analysed using Mann-Whitney (between two groups) or anlaysis of variance (ANOVA; among three groups) tests Statistical significance was considered at P < 0.05 The number of bacteria...

2
450
0

Báo cáo khoa học: "Effects of high doses of selenium, as sodium selenite, in septic shock: a placebo-controlled, randomized, double-blind, phase II study" docx

Ngày tải lên : 13/08/2014, 03:21

... Laboratory variables Haematological and biochemical analysis, arterial lactate and blood gases (allowing the determination of the PaO2/FiO2 ratio), blood cultures and cultures of specimen drawn ... ventilation, the ICU and hospital lengths of stay, and the mortality rates at ICU, at hospital discharge, and at 7, 14, 28 and 180 days and year after randomization Between February 2002 and 12 March ... Length of hospital stay before enrolment Admission category 0.003 Data presented as the mean ± standard deviation for quantitative variables and n (%) for qualitative variables aLevels of activity...

10
243
0

Báo cáo y học: " Status of complete proteome analysis by mass spectrometry: SILAC labeled yeast as a model system" ppt

Ngày tải lên : 14/08/2014, 16:21

... sequence reversing each entry and appending this database to the forward database Search parameters specified a MS tolerance of 10 ppm (see above) and an MS/MS tolerance at 0.5 Da and either full ... (where applicable) and N-pyroglutamate were allowed as variable modifications Due to the high mass accuracy, the 99% significance threshold (p < 0.01) in the yeast database search was a Mascot ... several fold interactions Figure of Degree sampling of SILAC peptide pairs Degree of sampling of SILAC peptide pairs Yeast was SILAC labeled as explained in Figure and one gel band was analyzed In principle,...

15
267
0

Validating an a priori enclosure using high order taylor series

Ngày tải lên : 12/01/2014, 22:06

... Current AWA Approach Validation and the computation of a tight enclosure are separate, though related, issues This paper addresses only the issue of validation, the role of Lohner's Algorithm ... enclosures for higher derivatives also in the general case Actually, he uses Theorem instead of Theorem and a special kind of interval polynomials for v](t) instead of a constant coarse enclosure as in ... Computation and Di erential Equations, Stanford, Calif., March 28 { April 1, 1995 10] R E Moore, The Automatic Analysis and Control of Error in Digital Computation Based on the Use of Interval Numbers,...

11
282
0

Building a Blog System using Yii pot

Ngày tải lên : 10/03/2014, 17:20

... CActiveRecord and can be used to access the tbl post database table; • models/Tag.php contains the Tag class that extends from CActiveRecord and can be used to access the tbl tag database table; • models/Comment.php ... blog database and establish the connection to it in the skeleton application 2.1.1 Creating Database We choose to create a SQLite database Because the database support in Yii is built on top of ... $dataProvider=new CActiveDataProvider(’Post’, array( ’pagination’=>array( ’pageSize’=>5, ), ’criteria’=>$criteria, )); $this->render(’index’,array( ’dataProvider’=>$dataProvider, )); } In the above,...

62
846
1

Báo cáo khoa học: "A Model-Theoretic Framework for Theories of Syntax" pdf

Ngày tải lên : 17/03/2014, 09:20

... Kracht (1995), and, anticipating all of these, Johnson and Postal (1980).) This approach abandons the notions of grammar mechanism and derivation in favor of defining languages as classes of ... develop a characterization of the context-free languages that is quite natural in the realm of GB This suggests that the apparent mismatch between formal language theory and natural languages may ... means that results concerning the complexity of natural languages will have implications for the nature of the human language faculty These automata-theoretic characterizations determine, along...

7
390
0

báo cáo hóa học:" Anti-angiogenic effect of high doses of ascorbic acid" pptx

Ngày tải lên : 18/06/2014, 15:20

... of AA In humans, these high- concentrations of AA can be achieved only by intravenous administration of AA The pharmacokinetics of high concentrations of AA has been summarized in research paper ... Journal of Translational Medicine 2008, 6:50 superoxide anion and other radicals High concentrations of ascorbic acid increase the availability of ascorbic acid radicals, resulting in reaction of ... Neovascularization by Ascorbic Acid in Rat Model [abstract] Graefes Arch Clin Exp Ophthalmol 2007, 245(10):1461-1467 Tamalarasan KP, Kolluru GK, Rajaram M, Indhumathy M, Saranya R, Chatterjee S: Thalidomide...

10
508
0

Báo cáo hóa học: " Research Article A Prototype System for Selective Dissemination of Broadcast News in European Portuguese" potx

Ngày tải lên : 22/06/2014, 20:20

... Other approaches are forced to use a smaller language model in the ﬁrst pass and rescore with a larger language model R Amaral et al Table 2: APP impact on speech recognition Segment boundary Manual ... deletion is a critical problem In fact, our TS algorithm has several pitfalls: (i) it fails when Table 3: Topic segmentation results APP Manual Manual Auto ASR Manual Auto Auto Recall % 88.8 88.8 ... notion was deﬁned as a seminal event or activity, along with all directly related events and activities.” Reference [1] as an example, a story about the victims and the damages of a volcanic eruption,...

11
429
0

Báo cáo y học: "Fluvoxamine may prevent onset of psychosis: a case report of a patient at ultra-high risk of psychotic disorde" ppt

Ngày tải lên : 09/08/2014, 01:21

... and Masaomi Iyo1,3 Department of Psychiatry, Chiba University Graduate School of Medicine, Chiba, Japan Department of Psychiatry, Sodegaura Satsukidai Hospital, Chiba, Japan Division of Clinical ... work, which lasted for more than years of follow-up Ethical approval The treatment of the reported case was made according to standard clinical practice, and ethical approval was obtained from ... Case presentation The patient was a 19-year-old Japanese unmarried office worker with no personal or familial history of psychiatric problems On presentation he complained of deterioration of...

8
356
0

Establishing a filipino identity using the philosophy of michel focault

Ngày tải lên : 05/10/2015, 21:28

... ungrounded and as changeable as, say, that of the classical or the modern episteme, what does that mean for the status of historical narratives? Are they accurate depictions of the frameworks of knowledge ... archive The archive defines a particular level that of a practice that causes a multiplicity of statements to emerge as so many regular events, as so many things to be dealt with and manipulated.30 ... is a calculated and measured response to criminality, it has three elements: the infliction of a measured amount of pain; the regulation of that pain; and the ritualistic character of the application...

109
454
0

AN0816 a CAN system using multiple MCP25050 IO expanders

Ngày tải lên : 11/01/2016, 14:27

... 255 Each time a message is received from a MCP25050, the received data is used to update the local binary and analog variables that maintain the state of the system If a binary or analog value ... Expander messages (ignored by Master Controller) All of the classes have associated data that is formatted in a specific manner that is fixed for an I/O Expander Detailed information is available ... CLASS DEFINITIONS Class Description CAN I/O Expander data packet containing GPIO digital inputs and A/ D values CAN I/O Expander PWM output values CAN I/O Expander Digital outputs All other CAN...

14
235
0

Development of a recommender system for the selection of software architecture methods

Ngày tải lên : 10/12/2016, 15:36

... thousand • usage of several thousands of applications and a huge IT-landscape • high demand on software architecture knowledge & management Florian Mittrücker - Master Thesis Background and motivation ... then evaluate” cycle Focus on building artefacts and relegate evaluation to a subsequent & separate phase Scant attention to the shaping of IT artefacts by the organizational context Fails that the ... Recommendation system Recommendation platform / Recommender system / Preference systems Databases • Several areas are involved: Information retrieval / Forecast theories / Marketing … • Five databases...

22
274
0

Optimization of design and operating parameters on the year round performance of a multi-stage evacuated solar desalination system using transient mathematical analysis

Ngày tải lên : 05/09/2013, 16:11

... temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged over the day ... inclined at an angle equal to latitude of Chennai (13o) facing towards due south for the maximum year round performance Each evaporator and condenser tray has an area of 1m2 inclined at an angle of ... performance and thermal characteristics of the system Description of the multi-stage evacuated solar desalination system The Multi-stage evacuated solar desalination system is a combination of evaporative-condenser...

26
568
0

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Ngày tải lên : 05/09/2013, 16:30

... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets of ... Nelder and Mead A global analysis of Tables and reveals an important outcome: the method of Powell systematically leads to the smallest values of the objective function and of the number of simulator ... mathematical optimization Table Results obtained with the genetic algorithm Decision variable Case Case EIS EIS Alternative Alternative Mathematical EIS optimization Alternative EIS Alternative Mathematical...

14
593
0

Tài liệu Báo cáo khoa học: "Enhanced word decomposition by calibrating the decision threshold of probabilistic models and using a model ensemble" pdf

Ngày tải lên : 20/02/2014, 04:20

... the mathematical model and performed experiments on language data of the morphologically complex language Zulu We compared the performance on increasing training set sizes and analysed for each ... 2006) They used a natural language tagger which was trained on the output of ParaMor and Morfessor The goal was to mimic each algorithm since ParaMor is rule-based and there is no access to Morfessor’s ... incorporating a probabilistic generative model. 1 Their parameters can be estimated from either labelled data, using maximum likelihood estimates, or from unlabelled data by expectation maximization2...

9
557
0

Tài liệu What is a high school worth?: A model of Australian private secondary school fees docx

Ngày tải lên : 20/02/2014, 19:20

... program An alternative to either of these is the International Baccalaureate (IB) and a small number of schools, mainly private, offer the IB diploma Table reports some standard VCE statistics across ... assessment Authority (VCAA) manages and awards school qualifications It administers and awards two senior school secondary qualifications known as the Victorian Certificate of education (VCE) and the ... Michaels; Thomas Carr; Westbourne Grammar Ballarat Associated Schools (bas) It is a group of schools in Ballarat, that provides the basis for interschool sporting competition Ballarat and Clarendon...

24
511
0

Báo cáo " Research, design and fabrication of a high-power combiner using Wilkinson bridge of L-band " pptx

Ngày tải lên : 22/03/2014, 11:20

... have also investigated the S11 factor of the power divider Wilkinson on network analyzer, the result was relatively similar to that of the simulink model Afterthat we have measured the characteristics ... Thanh, Nguyen Anh Tuan, Bach Gia Duong, Research, Design And Fabrication Of The 45W And The 200W, L-Band Power Amplifier Using The Modern Microstrip Technology For Application In The National ... was studied because this frequency will application in our the next reseach for design and fabrication of a transmitter system for the phase identification code D.T Thuy et al / VNU Journal of...

5
374
0