a model for sustainable development at the former border between east and west germany
Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt
... primers P4 (5¢-atgtagccattgtatttgaaaatgagcaact) and P5 (5¢- agttgctcattttcaaatacaatggctacat), and P6 (5¢- gaacagc cgtatttggccgcttattttgtatc) and P7 (5¢- gatacaaaataagcggccaaa tacggctgttc), respectively, ... pJZ12 In the same manner, the plasmid pJZ11, encoding the mutations C33 1A and C376S, was generated using primers P8 (5¢-ccctacggaaacaac gatcgctgcgactacatgggta) and P9 (5¢-tacccatgtagtcgcagcgatcg ... ttgtttccgtaggg), and P10 (5¢-tgaagctggtgaattatcgattggtggagaa ggg) and P11 (5¢-cccttctccaccaatcgataattcaccagcttca), respectively In order to combine all four mutations, an NdeI fragment containing the...
- 13
- 493
- 0
The UN Model Double Taxation Convention in the context of Financing for Sustainable Development
... review and update as necessary the UN Model Double Taxation Convention between Developed and Developing Countries and the Manual for the Negotiation of Bilateral Tax Treaties between Developed and ... International Tax Cooperation Economic and Social Council (ECOSOC) Relationship between international tax cooperation and financing for development emphasized in: UN Committee of Experts on International ... Provide a framework for dialogue with a view to enhancing and promoting cooperation among national tax authorities and assess how new and emerging issues could affect this cooperation • Make recommendations...
- 14
- 489
- 0
Tài liệu Does Foreign Direct Investment Work For Sustainable Development? A case study of the Brazilian pulp and paper industry potx
... Klabin and Aracruz that present data for years 2003, 2004 and 2005 and Cenibra which data are available only for 2005 ** The companies not have this value calculated All plants, excepting Aracruz and ... capital formation for the sector International Standart Organization - ISO Forest Stewardship Council - FSC The Brazilian Association for Pulp and Paper -5- Fieldwork: sample and methodology The ... lower than Cenibra in all parameters Votorantim, Suzano Bahia Sul, Ripasa and International paper are integrated producers of the writing and printing paper By calculating the average of the three...
- 23
- 894
- 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... The responsibility of the scientists is to screen among these alternatives the feasible measures based on applicability and suitability for the local conditions. 2.4. Evaluation criteria After the problem and its constraints have ... on diseases. Finally, the impact and area of impact are important for the aquaculture, agriculture, industries and other land users. Based on these criteria and the preference ... doing so, the consensus on the problems and their solutions can be reached. However, it is noted that MCA is subjective in its nature. In case the quantitative data are available, quantitative ...
- 13
- 487
- 0
Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx
... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... suggesting that the environment surrounding the transplanted cells could determine their final lineages [71] Advantages and disadvantages of using hESCs and hiPSCs for therapeutic applications The successful ... from Leukemia and Lymphoma UK, Fanconi New advances in human hematopoiesis from human ESCs Hope UK and the Fanconi Anemia Research Fund USA, and funds for research in the field of regenerative medicine...
- 12
- 550
- 0
Báo cáo khoa học: "Interpreting the variations in xylem sap flux density within the trunk of maritime pine (Pinus pinaster Ait.): application of a model for calculating water flows at tree and stand levels" pdf
... semi-cylindrical shape, and calculating the sap flux as the average of the measurements made at a height of m on a sample of ten trees at Carrasqueira and at a height of 8.5 m on seven We trees at the Bray ... compares the water potential values predicted by the model and the measured values, for day153 at the Bray site There is an acceptable agreement between the measured and predicted data, even if a ... used for estimating the branch and stem capacitance for day 153 We did not observe any clear change in the stem or branch capacitance for the four sample days at the Bray site 4.3 Model evaluation...
- 18
- 406
- 0
Industrial design strategies for sustainable development a case study of the packaging industry in singapore
... goals of the Singapore Packaging Agreement.” 3R Packaging Awards 2008 Communication Folder The Singapore Star Award The Asia Star Awards are organised annually by the Asian Packaging Federation ... examples used by Lovelock to demonstrate how oceanic algae and microorganisms are directly related to the rocks, the oceans and the atmosphere in a cycle that regulates the temperature of the ... to formulate a national strategy for Singapore’s sustainable development regarding domestic and global challenges According to the program’s guidelines, sustainable development means growing the...
- 136
- 756
- 0
Tài liệu Sustainable water management for rural development in the Mekong river delta, Vietnam pptx
... but also consider water-related problems in the future Processes of the urbanization and industrialization parallel to the rapid population growth lead to a greater water demand for upholding and ... farmers and agricultural related workers, are living in the rural and coastal areas where the natural conditions such as lands, water and plants closed density exist The rest of the MD's population ... is facing more and more water pollution by agricultural and industrial chemicals and domestic untreated wastewater In some places, this situation is threatening seriously the public health and...
- 6
- 606
- 0
Tài liệu REPORT BY THE DIRECTOR-GENERAL ON THE UNITED NATIONS DECADE OF EDUCATION FOR SUSTAINABLE DEVELOPMENT: INTERNATIONAL IMPLEMENTATION SCHEME AND UNESCO’S CONTRIBUTION TO THE IMPLEMENTATION OF THE DECADE doc
... identification of suitable and relevant indicators at every level – local, national, regional and international – and for each initiative and programme As the Decade puts major emphasis on cooperation ... environmental degradation needed international attention and collaboration rather than national approaches and solutions While some attention was attached to the social and economic issues inherent in these ... development plans and national education plans; - align policy, mandates, and other such frameworks to support ESD; - enable widespread awareness and understanding of education for sustainable development; ...
- 27
- 631
- 0
corporate social responsibility strategies for sustainable development for small and medium enterprises in the village of bac ninh province, vietnam
... DECLARATION I hereby declare that the graduation project is based on my research and experiences except the acknowledged aquotations and citations And, this graduation project has not been used at ... research applied the theories and models to analyze and assess the actual situation of production and business of small and medium enterprises in craft villages in Bac Ninh province and strategydevelopment ... differentiation) places are inadequate + Resources away from enterprises themselves + Foreign language and technology, information and should make sure, that progress, that withdrawal, restrictions the...
- 69
- 577
- 0
Báo cáo khoa học: Effects of the G376E and G157D mutations on the stability of yeast enolase – a model for human muscle enolase deficiency pdf
... phosphoenolpyruvate, and glycines 157 and 376 are space-filled 98 Analytical ultracentrifugation (AUC) was used to examine the quaternary structure of the variants Wild-type enolase and the G157D variant had ... denaturation, any change at these positions was destabilizing G37 6A and G376E had identical Tm values At position 157, alanine had a smaller effect than aspartate, but even alanine decreased the ... the QuickChange method (Stratagene, La Jolla, CA, USA) The primer sequences were as follows: 5¢-GG GGT GTT ATG GTT TCC CAT CGA TCT GAA GAA ACT GAA GAC (G376E) and 5¢-CCA TTC TTG AAC GTT TTA AAC...
- 10
- 520
- 0
Báo cáo khóa học: Vertical-scanning mutagenesis of amino acids in a model N-myristoylation motif reveals the major amino-terminal sequence requirements for protein N-myristoylation ppt
... GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG GCCGGGATCCATGGGCAAGCAGAATAGCGCACTGCGGCCAGACAAG GCCGGGATCCATGGGCAAGGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCAAGGCAGCATCTAAGGCAGCAGCAGACAAGCCTGTAGCC AATTAACCCTCACTAAAGGG ... ATATGGATCCATGGCTGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC ATATGGATCCATGGGCGCGGCAGCAGCGGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCATCTGCAGCAGCAGCAGACAAGCCTGTAGCC GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ... GCCGGGATCCATGGGCGCAGCAGCANNKGCAGCAGCAGCAGAC ATATGGATCCATGGGCNNKGCAGCAGCGGCAGCAGCAGCAGAC GCCGCTCGAGCCTGTAGCCCATGTT AATTCTCGAGTGCTGCTGCTGCCGATGCTGC AATTCTCGAGTGCTGCTGCTGCCGTTGCTGC AATTCTCGAGTGCTGCTGCTGCGAATGCTGC GCCGGGATCCATGGGCAAAACGCTGAGCAAAGAGGACAAGCTCGAG...
- 12
- 512
- 0
Báo cáo Y học: A model for recognition of polychlorinated dibenzo-p-dioxins by the aryl hydrocarbon receptor docx
... neither photoaf®nity labeled by a dioxin analog, nor activated by b-naphto¯avone in a yeast system [20]; the rainbow trout AhRa that binds TCDD [21] and the Microgadus Tomcod AhR also activated ... Comparison between the mAhR model (A, C) and the parental FixL PAS domain structure (B,D) In (A) and (B) residues that in¯uence the size of the ligand pocket are highlighted The arrow indicates the ... domain and PYP are activated by ligands; in FixL, oxygen binding at the heme binding PAS domain controls the activity of a histidine kinase domain [12]; and in PYP, a local conformational change...
- 6
- 569
- 0
War Bonds in the Second World War: A Model for a New Iraq/Afghanistan War Bond? docx
... States War Bonds to aid in funding of the operations in Iraq and Afghanistan.” All three bills are similar and state that the authorized war bonds “shall be in such form and denominations, and ... accrue earnings based on both a fixed rate of return and a semiannual inflation rate A single, annual rate, called the composite rate, reflects the combined effects of the fixed rate and the semiannual ... greater financial resources to purchase victory loans These sales absorbed potential consumer spending that would have exacerbated inflation and expanded black market activity The purchase of war...
- 7
- 361
- 0
THE REFORM OF THE SAVINGS BANK SYSTEM IN FRANCE – A MODEL FOR OTHER COUNTRIES? docx
... institutions The association acts principally as a forum for the exchange of ideas and the formation of opinions However, it also shares the responsibility with the National Bank of the savings banks ... (“Anstaltslast”) 10 nor a guaranty obligation (“Gewährträgerhaftung”)11 by the public authori- The National Association of the savings banks The National Association, as the second supreme body of the ... savings bank organisations As the National Association has limited decision-making powers, however, it plays only a subordinate role compared with the National Bank of the savings banks Against...
- 6
- 436
- 0
Báo cáo khoa học: "A Discriminative Hierarchical Model for Fast Coreference at Large Scale" ppt
... omitted Moves that reduce model score may be accepted and Jamie,Callan, an optional temperature can be used for annealing The primary advantages of MH for coreference are (1) only the compatibility ... hierarchical model is substantially faster than a pairwise model with a smaller state space One explanatory intuition comes from the statistical physics community: we can view the latent tree as ... over time for a 145k subset of the data Re- seconds to reach a 90% accuracy call that we initialized to the singleton configuration Related Work and that as the size of the entities grows, the cost...
- 10
- 303
- 0
báo cáo sinh học:" A model for integrating strategic planning and competence-based curriculum design in establishing a public health programme: the UNC Charlotte experience" doc
... program graduates – Program • Define the program’s academic goals and primary objectives Specify educational strategies/approaches • Define key educational strategies and approaches needed to achieve ... on the part of the faculty to examine assessment at both a course and a programmatic level: it may be fine to assess only a student's ability to calculate a chi-square statistic on a biostatistics ... end-of-class exam if the student will have to demonstrate the ability to determine which statistics are appropriate for a given set of data elsewhere in the curriculum Integration, application and practice...
- 10
- 577
- 0
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc
... Research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals and adhered to principles stated ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts ... terminal cardiac puncture Data for panels B-F are expressed as the average of values from four to five mice/timepoint and error bars indicate the standard deviation and this explains the low WBC and...
- 13
- 456
- 0
Báo cáo hóa học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" docx
... Research was conducted in compliance with the Animal Welfare Act and other federal statutes and regulations relating to animals and experiments involving animals and adhered to principles stated ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the large amounts ... terminal cardiac puncture Data for panels B-F are expressed as the average of values from four to five mice/timepoint and error bars indicate the standard deviation and this explains the low WBC and...
- 13
- 431
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25