a loss of function mutation produces a dominant trait

Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf

Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf

Ngày tải lên : 11/08/2014, 03:20
... 174:5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/NF- kappa B pathway in saturated ... Health and Human Sciences, Georgia State University, Atlanta, GA 30302, USA Authors’ contributions VG, VKM, ATG, and TRG designed research VKM, JDA, and FAC conducted research VG analyzed data ... Takeda K, Kaisho T, Akira S: Toll-like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi...
  • 7
  • 272
  • 0
Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx

Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx

Ngày tải lên : 11/08/2014, 06:22
... 174:5390-5397 Suganami T, Tamimoto-Koyama K, Nishida J, Iroh M, Yuan X, Mizuarai S, Kotami H, Yamaoka S, Miyake K, Aoe S, Kamei Y, Ogawa Y: Role of the tolllike receptor 4/NF- kappa B pathway in saturated ... Health and Human Sciences, Georgia State University, Atlanta, GA 30302, USA Authors’ contributions VG, VKM, ATG, and TRG designed research VKM, JDA, and FAC conducted research VG analyzed data ... Takeda K, Kaisho T, Akira S: Toll-like receptors Annu Rev Immunol 2003, 21:335-376 Tsukumo DM, Carvalho-Filho MA, Carvalheira JB, Prada PO, Hirabara S, Schenka AA, Araujo EP, Vassallo J, Curi...
  • 7
  • 238
  • 0
Báo cáo Y học: A novel gain-of-function mutation of the integrin a2 VWFA domain docx

Báo cáo Y học: A novel gain-of-function mutation of the integrin a2 VWFA domain docx

Ngày tải lên : 08/03/2014, 22:20
... 5¢-TTCAATGTGTCTGATTGGGCAGCTCTACTAGA AAAGGCTG-3¢; for E318 to I, 5¢-CAATGTGTCTGA TATAGCAGCTCTACTAGAAAAG-3¢; for E318 to R, 5¢-CAATGTGTCTGATCGAGCAGCTCTACTAGAAA AG-3¢; for E318 to Y, 5¢-CAATGTGTCTGATTATGCA ... study Lancet 353, 351–353 20 Matsubara, Y., Murata, M., Maruyama, T., Handa, M., Yamagata, N., Watanabe, G., Saruta, T & Ikeda, Y (2000) Association between diabetic retinopathy and genetic variations ... ligands of a2 b1 These data indicate that E318W has a similar effect on a2 as F302 does on aM and that residue E318 has an important role in modulating a2 VWFA domain function MATERIALS AND METHODS...
  • 9
  • 471
  • 0
báo cáo khoa học: "Loss-of-function mutations affecting a specific Glycine max R2R3 MYB transcription factor result in brown hilum and brown seed coats" docx

báo cáo khoa học: "Loss-of-function mutations affecting a specific Glycine max R2R3 MYB transcription factor result in brown hilum and brown seed coats" docx

Ngày tải lên : 11/08/2014, 11:21
... Y, Yamamoto K, Shimada N, Yamamura S, Nishihara M: Identification and characterization of R2R3-MYB and bHLH transcription factors regulating anthocyanin biosynthesis in gentian flowers Plant and ... pigments, and also the regulation of those enzymes and pathways by coordinated interaction of transcriptional activators have largely been resolved One of the characteristic features of the accumulation ... US Department of Agriculture, Agricultural Research Service, Midwest Area, is an equal opportunity, affirmative action employer and all agency services are available without discrimination Author...
  • 12
  • 296
  • 0
Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

Tài liệu Báo cáo khoa học: TEC family kinases in health and disease – loss-of-function of BTK and ITK and the gain-of-function fusions ITK–SYK and BTK–SYK pptx

Ngày tải lên : 14/02/2014, 18:20
... 287–299 Plebani A, Soresina A, Rondelli R, Amato GM, Azzari C, Cardinale F, Cazzola G, Consolini R, De Mattia D, Dell’Erba G et al (2002) Clinical, immunological, and molecular analysis in a large cohort ... Belohradsky BH, Haire RN, Holinski-Feder E, Kwan SP, Lappalainen I, Lehvaslaiho H, Lester T, Meindl A, Ochs HD et al (1997) BTKbase, mutation database for X-linked agammaglobulinemia (XLA) Nucleic ... 355–358 Rawlings DJ, Saffran DC, Tsukada S, Largaespada DA, Grimaldi JC, Cohen L, Mohr RN, Bazan JF, Howard M, Copeland NG et al (1993) Mutation of unique region of Bruton’s tyrosine kinase in...
  • 10
  • 926
  • 0
Báo cáo Y học: Loss-of-function variants of the human melanocortin-1 receptor gene in melanoma cells define structural determinants of receptor function doc

Báo cáo Y học: Loss-of-function variants of the human melanocortin-1 receptor gene in melanoma cells define structural determinants of receptor function doc

Ngày tải lên : 17/03/2014, 10:20
... variant was indeed present in the sample and was not the result of a PCR artifact was ascertained by repeated amplification and sequencing reactions, and by the observation that the same allele was ... view, an association of several MC1R allelic variants with increased melanoma and nonmelanoma skin cancer risk has been demonstrated [19–21] These variants were subsequently shown to be loss- offunction ... CGCGAATTCTACCCA TACGAT (forward) and AGCTCTAGATTAGTGGT GATG (reverse), containing EcoRI and XbaI sites (underlined) We also amplified the complete coding sequence of the wild-type and Leu93Arg variant...
  • 9
  • 356
  • 0
Báo cáo y học: "Broad network-based predictability of Saccharomyces cerevisiae gene loss-of-function phenotypes" pdf

Báo cáo y học: "Broad network-based predictability of Saccharomyces cerevisiae gene loss-of-function phenotypes" pdf

Ngày tải lên : 14/08/2014, 08:20
... into a single category, such as collapsing 'Cataract, polymorphic and lamellar' and 'Cataract, crystalline aculeiform' into a single category of cataract defects) Each human disease gene was mapped ... Saka A, Fukuda T, Ishihara S, Oka S, et al.: High-dimensional and largescale phenotyping of yeast mutants Proc Natl Acad Sci USA 2005, 102:19015-19020 Mnaimneh S, Davierwala AP, Haynes J, Moffat ... principal, the approach we describe could be applied to any organism, using functional network data if available or, in the absence of such data, using physical interaction data, such as available...
  • 20
  • 181
  • 0
báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" pdf

báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" pdf

Ngày tải lên : 20/06/2014, 04:20
... triangular fibrocartilage and the distal end of the ulna[1] The limitation of external fixation to achieve articular Table Grading of Radiocarpal arthritis Grade Arthritis Bone graft was harvested ... http://www.josr-online.com/content/6/1/23 Page 10 of 10 14 Kapoor H, Agarwal A, Dhaon B: Displaced intraarticular fractures of distal radius: a comparative evaluation of results following closed reduction, external fixation and open ... Postoperative Radiograph (Anteroposterior and Lateral view) Figure 10 Case Radiograph at year followup Anteroposetrior and Lateral view Page of 10 Raju and Kini Journal of Orthopaedic Surgery and Research...
  • 10
  • 427
  • 0
báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" potx

báo cáo hóa học:" Loss of correction in unstable comminuted distal radius fractures with external fixation and bone grafting -a long term followup study" potx

Ngày tải lên : 20/06/2014, 07:20
... triangular fibrocartilage and the distal end of the ulna[1] The limitation of external fixation to achieve articular Table Grading of Radiocarpal arthritis Grade Arthritis Bone graft was harvested ... http://www.josr-online.com/content/6/1/23 Page 10 of 10 14 Kapoor H, Agarwal A, Dhaon B: Displaced intraarticular fractures of distal radius: a comparative evaluation of results following closed reduction, external fixation and open ... Postoperative Radiograph (Anteroposterior and Lateral view) Figure 10 Case Radiograph at year followup Anteroposetrior and Lateral view Page of 10 Raju and Kini Journal of Orthopaedic Surgery and Research...
  • 10
  • 335
  • 0
Báo cáo y học: "Conventional radiography requires a MRI-estimated bone volume loss of 20% to 30% to allow certain detection of bone erosions in rheumatoid arthritis metacarpophalangeal joints" ppsx

Báo cáo y học: "Conventional radiography requires a MRI-estimated bone volume loss of 20% to 30% to allow certain detection of bone erosions in rheumatoid arthritis metacarpophalangeal joints" ppsx

Ngày tải lên : 09/08/2014, 07:20
... data, analysis of data and interpretation of data and writing the manuscript AaV: acquisition and analysis of data SJ: interpretation of data and drafting the manuscript HST: acquisition and analysis ... analysis of data MØ: study design, analysis of data and interpretation of data and writing the manuscript Acknowledgements Amersham Health The Danish Rheumatism Association References Arnett FC, ... of cm Merge eFilm™(Milwaukee, Wisconsin, USA) workstation, a commercially available software package, was used for the readings of the MRI images This software enables digital image viewing and...
  • 4
  • 356
  • 0
Báo cáo y học: "Knee meniscal extrusion in a largely non-osteoarthritic cohort: association with greater loss of cartilage volume" pps

Báo cáo y học: "Knee meniscal extrusion in a largely non-osteoarthritic cohort: association with greater loss of cartilage volume" pps

Ngày tải lên : 09/08/2014, 10:20
... tibial plateau bone was measured manually on the three reformatted images closest to tibial cartilage An average of these three areas was used as an estimate of the tibial plateau bone area [12,15] ... means of image processing on an independent workstation at baseline and follow up The volumes of individual cartilage plates (medial tibia and femora, and lateral tibia and femora) were isolated ... significantly associated with loss of medial tibiofemoral cartilage volume over years after adjustment for the above factors as well as bone changes Our data suggest that tibial bone area and osteophytes...
  • 8
  • 336
  • 0
Báo cáo y học: " A 1-year case-control study in patients with rheumatoid arthritis indicates prevention of loss of bone mineral density in both responders and nonresponders to infliximab" docx

Báo cáo y học: " A 1-year case-control study in patients with rheumatoid arthritis indicates prevention of loss of bone mineral density in both responders and nonresponders to infliximab" docx

Ngày tải lên : 09/08/2014, 10:20
... [12], and a good clinical response was defined as an improvement of at least 1.2 in DAS28 score at year Bone mineral density evaluation At baseline and year later, BMD (g/cm2) was determined at ... (continuous variables and discrete variables) on that of infliximab DAS, Disease Activity Score Bone loss in RA patients depends on a number of factors This patient population is already at high risk ... soluble receptor activator of nuclear factor kappa B ligand in serum of rheumatoid arthritis patients and their normalization after anti-tumor necrosis factor alpha treatment Arthritis Rheum 2002,...
  • 7
  • 498
  • 0
Báo cáo y học: "Risk factors associated with the loss of cartilage volume on weight-bearing areas in knee osteoarthritis patients assessed by quantitative magnetic resonance imaging: a longitudinal study" pot

Báo cáo y học: "Risk factors associated with the loss of cartilage volume on weight-bearing areas in knee osteoarthritis patients assessed by quantitative magnetic resonance imaging: a longitudinal study" pot

Ngày tải lên : 09/08/2014, 10:20
... design, acquisition of data, analysis and interpretation of data, and statistical analysis M-JB and FA contributed to acquisition of data and to analysis and interpretation of data DC and BH contributed ... consultants of ArthroVision Authors' contributions J-PP and JM-P contributed to study design, acquisition of data, analysis and interpretation of data, manuscript preparation, and statistical analysis ... to acquisition of data JFB, GAC, and JMM contributed to manuscript preparation All authors read and approved the final manuscript Acknowledgements The authors thank Virginia Wallis and Santa Fiori...
  • 11
  • 518
  • 0
Báo cáo sinh học: "Champagne, a dominant color dilution of horses" docx

Báo cáo sinh học: "Champagne, a dominant color dilution of horses" docx

Ngày tải lên : 09/08/2014, 18:22
... results of mating individual champagne dilute stallions and mares available, and are presented in table I These included several Tennessee Walking Horses, and one Spanish Mustang The matings were all ... champagne and 40 nonchampagne foals Under the hypothesis that the champagne allele is dominant, X= 2.1, df, P > 0.1 This allele is proposed as the champagne allele at the Champagne locus All horses ... interpretation of the champagne allele as an incomplete dominant The lack of nondilute horses from these matings is an indication that perhaps not all foals are reported If this is the case, then...
  • 6
  • 223
  • 0
báo cáo khoa học: "Takayasu’s arteritis presenting with temporary loss of vision in a 23-year-old woman with beta thalassemia trait: a case report" pptx

báo cáo khoa học: "Takayasu’s arteritis presenting with temporary loss of vision in a 23-year-old woman with beta thalassemia trait: a case report" pptx

Ngày tải lên : 10/08/2014, 23:20
... electrocardiogram, echocardiograph and electroencephalogram (EEG) A computed tomography angiogram (CT -A) of her chest showed a normal ascending aorta, descending aorta and arch of the aorta but ... [5] Fifty percent of patients with TA have a normal ESR [6] Patients with beta thalassemia trait also have a raised ESR Anemia in TA can be normocytic and normochromic, but our patient presented ... because they are not associated with large vessel stenosis as seen in TA Large vessel vasculitis was ruled out because it is associated with the advanced age (Kawasaki disease and giant-cell arteritis)...
  • 3
  • 839
  • 0
báo cáo khoa học: " Behavioral changes of patients after orthognathic surgery develop on the basis of the loss of vomeronasal organ: a hypothesis" pptx

báo cáo khoa học: " Behavioral changes of patients after orthognathic surgery develop on the basis of the loss of vomeronasal organ: a hypothesis" pptx

Ngày tải lên : 11/08/2014, 20:20
... Comparison of habitual masticatory cycles and muscle activity before and after orthognathic surgery J Oral Maxillofac Surg 1997, 55:699-707 Cuccia AM, Campisi G, Cannavale R, Colella G: Obesity and ... normal and abnormal personality dimensions: a 2-year follow-up study of 61 patients Am J Orthod Dentofacial Orthop 1990, 98:313-322 Jacobson A: Psychological aspects of dentofacial esthetics and ... design, and analysis and interpretation of data, both have been involved in drafting the manuscript or revising it critically for important intellectual content, and have given final approval of the...
  • 5
  • 334
  • 0
Báo cáo y học: " A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus" pptx

Báo cáo y học: " A Leu to Ile but not Leu to Val change at HIV-1 reverse transcriptase codon 74 in the background of K65R mutation leads to an increased processivity of K65R+L74I enzyme and a replication competent virus" pptx

Ngày tải lên : 11/08/2014, 21:21
... for each RT and statistical values that include mean, median, standard deviation and maximum and minimum were obtained A paired analysis with ttest was performed to compare the density of cDNA products ... and mutated (AAA/AGA) cDNA, and generated regression line between ratios of peak heights for A and ‘G’ nucleotides (A/ G) and cDNA concentrations (Figure 3) The percentages of observed and actual ... effect of compensatory mutations on viral replication and RT has been previously analyzed by several laboratories [34,38,39] In an era of combination therapy and the selection of MDR mutations,...
  • 12
  • 369
  • 0
Báo cáo y học: " Isolated loss of inferior pubic ramus: a case report Aly Saber" pdf

Báo cáo y học: " Isolated loss of inferior pubic ramus: a case report Aly Saber" pdf

Ngày tải lên : 11/08/2014, 21:22
... revealed a number of clinical syndromes associated with hypoplasia of ischiopubic bone: small patella syndrome, nailpatella syndrome, ischiopubic-patellar hypoplasia, and ischiopubic hypoplasia All ... the literature Small patella syndrome (SPS) is characterized by patellar aplasia or hypoplasia and by anomalies of the pelvis and feet, including disrupted ossification of the ischia and inferior ... complaints was also reported in a 77-year-old woman with nail patella syndrome [12] Hypoplasia of the ischiopubic region together with spinal dysraphism and scoliosis as well as bilateral aplasia...
  • 4
  • 349
  • 0
Báo cáo y học: "The loss of health status in rheumatoid arthritis and the effect of biologic therapy: a longitudinal observational study" pot

Báo cáo y học: "The loss of health status in rheumatoid arthritis and the effect of biologic therapy: a longitudinal observational study" pot

Ngày tải lên : 12/08/2014, 11:23
... in RA is indistinguishable from population normative data No population normative data are available for the HAQ, but its pattern of loss is similar to that of PCS and EQ-5D These data can be ... Moreland LW, Weisman MH, Birbara CA, Teoh LA, Fischkoff SA, Chartash EK: Adalimumab, a fully human anti-tumor necrosis factor alpha monoclonal antibody, for the treatment of rheumatoid arthritis ... EQ-5D, and HAQ graphs show substantial loss of health status over 60 years, the actual mean annual loss is very small, virtually imperceptible Table and Figure provide information about the rate of...
  • 12
  • 385
  • 0
Báo cáo y học: "Mutagenesis of tyrosine and di-leucine motifs in the HIV-1 envelope cytoplasmic domain results in a loss of Env-mediated fusion and infectivi" pps

Báo cáo y học: "Mutagenesis of tyrosine and di-leucine motifs in the HIV-1 envelope cytoplasmic domain results in a loss of Env-mediated fusion and infectivi" pps

Ngày tải lên : 13/08/2014, 01:20
... TGTTAACGCGGCCAATGCCAATGCCACAGC3’, LL814AARP - 5’GGCATTGGCCGCGT TAACAGCACTATTC3’, LL855AAFP - 5’GGGCTTGGAAAGGATTGCGGCATAAGATGGG3’, LL855ARP - 5’CCCATCTTATGCCGCAATCCTTTCCAAGCCC3’ All Env CD mutants were ... 5’CCCCCTGCGTCCCAGAAGTTCCACA-ATCCTCG3’, Y795S/LL799HQ/Y802SFP - 5’GGAAGCCCTCAAACTTGGTGGAATCACCAACAGTCTTGGAGTCAGG3’, Y795S/LL799HQ/Y802SRP - 5’CCTGACTCCAAGACTGTTGGTGATTCCACCAAGATTTGAGGGCTTCC3’, LL814AAFP - 5’GC TGTTAACGCGGCCAATGCCAATGCCACAGC3’, ... 5’GCTCCCACCGCTCGAAAGACTCACACTCGAATGTAACGAGG3’, L771/LLLI774SHSSRP - 5’CCTCGTTACATTCGAGTGTGAGTCTTTCGAGCGGTGGGAGC3’, LL784HQFP - 5’CGAGGATTGTGGAACTTCTGGGACGCAGGGGG3’, LL784HQRP - 5’CCCCCTGCGTCCCAGAAGTTCCACA-ATCCTCG3’,...
  • 17
  • 362
  • 0