a long game but a strong game—
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... be statistically significant at a 10% level in the univariate analysis and subjected to multivariate Cox regression analysis: lactate, APACHE II score, SOFA score and circulating Ang-2 (Table ... limitation for Ang-2 as a quantitative marker for vascular permeability: high Ang-2 might be a surrogate parameter for increased capillary permeability per se, but is a poor marker for the absolute ... coefficient and linear regression analysis was performed after logarithmic transformation of Ang-2 values (logAng-2) The primary outcome studied was 30-day survival and was calculated from the day of...
- 9
- 634
- 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... lacUV5 and trc were amplified by PCR from vectors including the relevant genes By using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was ... ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter region ... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI downstream of...
- 11
- 445
- 0
THE PRESIDENT’S PLAN FOR A STRONG MIDDLE CLASS & A STRONG AMERICA pptx
... building a strong middle class and a strong America EMBARGOED UNTIL DELIVERY OF THE PRESIDENT’S STATE OF THE UNION ADDRESS MAKING AMERICA A MAGNET FOR JOBS Bringing good manufacturing jobs back ... development on federal lands and offshore, has broad non-partisan support, including retired admirals and generals and leading CEOs It is focused around one achievable goal: shifting our cars and trucks ... banning military-style assault weapons and high-capacity magazines, and taking other commonsense steps to reduce gun violence; (3) making schools safer; and (4) increasing access to mental health...
- 9
- 438
- 0
Báo cáo khoa học: Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants ppt
... supplementation The above data reveals that a requirement for uptake of aromatic amino acids from the culture medium leads to unusually high sensitivity to weak organic acid stress An increased capacity ... the major facilitator superfamily, is required for adaptation to acetic acid and resistance to azoles in Saccharomyces cerevisiae Yeast 16, 1469–1481 Wach, A. , Brachat, A. , Poehlmann, R & Philippsen, ... transketolase reaction [19] Weak acid stress in yeast is acting in a fundamentally different way It is not generating an auxotrophy for aromatic amino acids in wild-type cells, but rather is causing...
- 7
- 391
- 0
200 YEARS OF SAVINGS BANKS: A STRONG AND LASTING BUSINESS MODEL FOR RESPONSIBLE, REGIONAL RETAIL BANKING pot
... risky and increased at the same time as commercial loans, also based on personal relationships A savings bank was not primarily an independent organisation, but rather a part of local business Table ... 36 In many cases, loans were granted to the members of savings bank boards of directors, but also against personal guarantee and against collateral In ports, loans were usually granted against ... bank the first mortgage loan against security in land was granted on the first banking day During the 1850s and 1860s, lending was based on real estate mortgages, but loans against shares gradually...
- 164
- 309
- 0
Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite specificity with a strong preference for small polar side chains docx
... wild-type a1 AT SDS ⁄ PAGE analysis of complex formation confirmed that mesotrypsin covalently associated with a1 AT Pittsburgh, in a manner that was essentially identical to inhibition of cationic and anionic ... play a role in either activation or degradation of pancreatic protease zymogens were proven untenable, because several laboratories showed that mesotrypsin did not activate human cationic or anionic ... inactivated by a1 AT Pittsburgh The natural Pittsburgh variant of a1 AT contains an Arg residue in place of the P1 Met358 in the reactivesite peptide bond [15,16] Because of this change, the a1 AT...
- 13
- 433
- 0
an oh maser flare with a strong magnetic field in w75n
... This Zeeman pair was probably overlooked by the authors, or dismissed as showing too large a velocity separation d From EVN data are really new as they are related to the flare which took place between ... have also been found near the OH masers in W75N, located in two clusters around VLA1 and VLA2 Torrelles et al (2003) have found a shell of water masers around the ultra-compact HII region VLA2 ... close to VLA2, at a distance of 55 mas (±40 mas), or at the projected distance of 110 AU (±80 AU) Therefore, the OH masers may well be located in the same shell as the water masers The magnetic...
- 2
- 250
- 0
Báo cáo sinh học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" pptx
... HCV-RNA PCR has been validated and is used as a routine Table 1: Characteristics of Cases with spontaneous HCV clearance Subject # Age (Years) Risk factor Duration of IVDU (months) HLA class I Peak ... JJ, Pan Y, Freeman AJ, Harvey CE, White PA, Palladinetti P, Haber PS, Marinos G, Levy MH, Kaldor JM, Dolan KA, Ffrench RA, Lloyd AR, Rawlinson WD: Clearance of hepatitis C viremia associated ... hepatitis with about ten times elevated ALT levels A robust response against HCVhelicase was found in the proliferation assay at baseline and after clearance of HCV-RNA (SI values of 4.1 and 3.6, respectively)...
- 11
- 528
- 0
Báo cáo hóa học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" potx
... HCV-RNA PCR has been validated and is used as a routine Table 1: Characteristics of Cases with spontaneous HCV clearance Subject # Age (Years) Risk factor Duration of IVDU (months) HLA class I Peak ... JJ, Pan Y, Freeman AJ, Harvey CE, White PA, Palladinetti P, Haber PS, Marinos G, Levy MH, Kaldor JM, Dolan KA, Ffrench RA, Lloyd AR, Rawlinson WD: Clearance of hepatitis C viremia associated ... hepatitis with about ten times elevated ALT levels A robust response against HCVhelicase was found in the proliferation assay at baseline and after clearance of HCV-RNA (SI values of 4.1 and 3.6, respectively)...
- 11
- 440
- 0
Báo cáo hóa học: " A strong convergence theorem on solving common solutions for generalized equilibrium problems and fixed-point problems in Banach space" pptx
... problems in Banach spacesm J Inequal Appl 2010, 2010:14, (Article ID 869684) 12 Cioranescu I: Geometry of Banach spaces, Duality Mappings and Nonlinear Problems In Mathematics and Its Applications ... Appl 2008, 2008:11, (Article ID 528476) Takahashi W, Zembayashi K: Strong and weak convergence theorems for equilibrium problems and relatively nonexpansive mappings in Banach spaces Nonlinear ... W: Strong convergence of a proxiaml-type algorithm in a Banach space SIAM J Optim 2002, 13(3):938-945 15 Kohsaka F, Takahashi W: Existence and approximation of fixed points of firmly nonexpansive-type...
- 13
- 297
- 0
Báo cáo hóa học: " Research Article A Strong Limit Theorem for Weighted Sums of Sequences of Negatively Dependent Random Variables" potx
... their valuable comments and some helpful suggestions that improved the clarity and readability of the paper This Journal of Inequalities and Applications work was supported by the National Natural ... Georgia, 1993 K Joag-Dev and F Proschan, “Negative association of random variables, with applications,” The Annals of Statistics, vol 11, no 1, pp 286–295, 1983 A Bozorgnia, R F Patterson, and ... dependent random variables,” Pakistan Journal of Statistics, vol 21, no 3, pp 257–264, 2005 H R Nili Sani, M Amini, and A Bozorgnia, Strong laws for weighted sums of negative dependent random variables,”...
- 8
- 326
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25