... to the extraposition cases, I will recast it in terms ofa closely related automaton, the Bottom-up EPDA (BEPDA) ~ The BEPDA consists ofa finite-state control and ofa stack of stacks There are ... of moves: either an input is read and pushed onto a new stack on top ofthe stack of stacks, or a fixed number of stacks below and above a designated stack on the stack of stacks is removed and ... than an EPDA has two advantages: first, the data-driven bottom-up automaton represents a more intuitive model of human sentence processing than the top-down automaton; second, the grammar that...
... and meta -analysis of all randomised controlled trials (RCTs) of pharmacological and non-pharmacological treatments that are available in standard primary care settings and those that are administered ... fibromyalgia when comparing primary care and specialised care Our meta -analysis demonstrates that there are no differences in the overall outcome of fibromyalgia regardless ofthelevelof care ... Garcia-Campayo et al Table Characteristics ofthe 33 selected randomised controlled trials and the patients studied in them Treatment Levelof care % of women Mean age Length of treatment (years)...
... formed by two antecedents attitude toward act or behaviour (AACT) and subjective norm (SN) AACT represents the evaluation ofthe advantages and disadvantages associated with the performance ofa given ... populations Innovation can be studied at four distinct levels: the individual healthcare professionals; the healthcare professionals groups; the healthcare organisations; and the larger healthcare ... that are used to assess the reliability of individual data aggregated at group level in hierarchical models, such as the intra-class correlation (ICC1 and ICC2), the eta-squared (η2), and the...
... out data management, analysisofthe data including multilevel modeling, interpretation of data, and created the first draft ofthe manuscript EN was involved with the management of data, participated ... using parallel statistical methods, and the two years' data were treated as replicate studies Multilevel analysis was chosen to account for the hierarchical nature ofthe data (lifeguards nested ... participated in theanalysis and interpretation of data, and provided revisions on the content ofthe manuscript TE coordinated the original data collection and was involved with the data management...
... 17 AN ANALYSISOFTHE INAUGURAL ADDRESS BY G.W BUSH IN THE U.S PRESIDENTIAL ELECTION 2004 FROM A PERSPECTIVE OF D .A DATA ANALYSIS AND DISCUSSION 3.1 Analysisof data 3.1.1 Lexical choice By referring ... indicates the evaluation ofthe speaker toward the truth or probability ofa representation of reality From that base, we have an account ofthe two types of modality in the speech and times of their ... developed and it lies in the remainder ofthe clause Normally, the choice of Theme reveals the meaning ofthe clause, more particularly the thematic meaning that clause conveys Theme/Rheme has relations...
... PH17P(+) PA55G()) PA55G(+) PT69G()) PT69G(+) TTGTACGTTGCGAACAACCCCGGACAAT ATTGTCCGGGGTTGTTCGCAACGTACAA TTGTACGTTGCAATCAACCCCGGACAAT ATTGTCCGGGGTTGATTGCAACGTACAA ACCACAGGTGTTGTACATTGCGATCAACC GGTTGATCGCAATGTACAACACCTGTGGT ... GGTTGATCGCAATGTACAACACCTGTGGT TCCTACCGCAGGTCCTGAGCAGCAGGGA TCCCTGCTGCTCAGGACCTGCGGTAGGA TTTGCCCGCACTGGCGGCTTTGCGGTGTC GACACCGCAAAGCCGCCAGTGCGGGCAAA TTGGCATACGTACCACAGGTGTTGTAC GTACAACACCTCCGGTACGTATGCCAA ... For the significance ofthe RNA binding data, a Levene statistical was used for acceptance of variance equality One-way ANOVA and Bonferroni analyses were used to evaluate the data to a 95% level...
... (1974) As the wave number ka increases The wave forces on the cylinders oscillate around the wave forces on an isolated cylinder As the cylinder spacing increases, the wave force on the cylinders ... not decrease linear to the wave force on an isolated cylinder, however it oscillates around the wave force on an isolated cylinder The amplitude of oscillation is extremely large as the ratio ... to the interaction ofthe cylinders, the run-up profiles ofthe cylinders are quite different from that of an isolated cylinder This numerical computation method will be used broadly for analysis...
... language, a language of education, a working language, a lingua franca, (a language for) the expression of national identity and an international language” (p.74) The paramount concern ofthe government ... 2002:281) In the Singaporean context, the government’s emphasis on the mastery ofthe standard variety of English as a means towards maximising competitive advantage is clearly a case of language commodification ... comprehensive than the diglossia framework because it examines variation both along a cline of proficiency as well as of formality An even more recent approach to theanalysisof Singapore English is the...
... Aid Program commonly known as The Marshall Plan General Marshall was awarded the Nobel Peace Prize in 1953 for his role as architect and advocate ofthe Marshall Plan A text analysisofThe 2014 ... to react in a particular way after having heard the text The usage of particular (and appealing) texts is essential in discourses where verbal means are the only way of influencing the addressees‘ ... approach, and in the meantime, make the smartest application ofthe technology that you already have […] The AIDS epidemic offers an example The broad goal, of course, is to end the disease The highest-leverage...
... cortex and pyramidal tract to the ventral brain stem The involuntary path is comprised of amygdala, thalamic, hypothalamic, and subthalamic areas, in addition to the dorsal brain stem Moreover, the ... “yes”, the survey was discarded assuming the participant did not fully understand the question Statistical analysisThe data was analyzed using both parametric and non parametric statistics and the ... pathways, the “voluntary path” and the “involuntary path” otherwise known as the “emotionally-driven path” (5) The voluntary pathway begins from the premotor opercular areas and travels via the...
... Positivization ofthe US- Japan coalition’s activities in VOA Table Lexicalization of North Korea’s activities in Nhan Dan Table Lexicalization ofthe US-Japan coalition’s activities in Nhan Dan Table ... LIST OF TABLES Table Names for US-Japan coalition and North Korea in VOA Table Names for US-Japan coalition and North Korea in Nhan Dan Table Negativization of North Korea’s activities in VOA Table ... Over-lexicalization ofthe North Korea’s missile launches in VOA Table Over-lexicalization ofthe North Korea’s missile launches in Nhan Dan Table Quotation patterns of news reports in VOA Table 10...
... from the Voice of America and Nhan Dan These two sources are chosen as the database for theanalysis as they are both popular and reliable sources of information 2.1.1.1 Voice Of America The Voice ... the rationale, the scope ofthe research, the aims ofthe research, the methodology and the design ofthe research - Part 2- Development: This is the main part ofthe thesis and has three chapters ... particularly associated with Michael Halliday (Halliday 1978, 1994), is an approach to language that views language in its social context, as an instrument of social interaction, rather than a...
... processes are attributed to the US and Japan (76.9%) and all these processes are either verbal (60%) or material (40%) The US and Japan play the role of actor and sayer in all the processes In material ... explicitly associates the US and Japan with positive values and goals 3.2.2.2 Nhan Dan Theanalysisof lexicalization shows that in Nhan Dan the wordings for North Korea’s and the US- Japan coalition’s ... participants By using neutral and formal names to refer to both North Korea and the US- Japan coalition, Nhan Dan treated them equally and viewed them as having equal right and power Theanalysisof lexicalization...
... II APPENDIX Headlines from Nhan Dan ND1* Triều Tiên thử tên l a, Mỹ Nhật Bản đe d a trừng phạt 05/07/2006 ND2* Trung Quốc quan tâm, Nhật Bản tiếp tục đàm phán vấn đề tên l a Triều Tiên ... Trung Quốc Nga đ a dự thảo nghị vấn đề tên l a Triều Tiên 13/07/2006 ND10 Các nước thường trực HĐBA LHQ họp vấn đề tên l a Bình Nhưỡng 14/07/2006 ND11* LHQ thông qua nghị vấn đề tên l a Triều Tiên ... trừng phạt thêm Mỹ Triều Tiên 21/07/2006 Note : The news reports marked with (*) are sampled for full-text analysis III ...
... of America and Nhan Dan Aims ofthe research To provide a textual analysis To give an illustration of CDA concepts and analysis procedures To convey a message Research questions What are the ... VOA Formal and neutral names for the US and Japan Negative names for NK Nhan Dan formal and neutral names for both groups of participants lexicalization VOA Negativization of NK’s activities ... the roles ? Analyzing full-text news reports Naming referents Lexicalization Over-lexicalization Quotation patterns Data analysis and discussion Analysisof headlines Analysisof full-text...
... in language B He considers CA as a form of interlanguage study and as a central and substantial component of applied linguistics As a matter of fact, CA has had much to offer to practical teaching ... modal in a certain situation makes clear which meaning is intended An effort has also been made to have a contrastive analysisofthe meanings expressed via the modal verbs can, may, must and the ... with other verbs to create verb phrases in the sentence 1.4 Contrastive analysis (CA) As one ofthe main aims of this paper is to carry out a contrastive analysis on the meanings expressed via the...