a laser scanner system for acquiring walking trajectory data and its possible application to behavioral science

Design and control of a teleoperation system for humanoid walking

Design and control of a teleoperation system for humanoid walking

Ngày tải lên : 04/10/2015, 10:25
... and action data Figure 2.1: A typical teleoperation configuration Sensing - receives data from the external environment (both master and slave) and transmits to the brain Decision making - based ... the data from sensing operator and the knowledge of the task and make necessary decision Mechanical action - taking the command of the decision making operator and generation of physical actions ... designed as a rigid frame that is attached to a backpack with shoulder strap The reason for choosing the backpack is that it is a ready-made solution for the problem of close and comfortable attachment...
  • 93
  • 336
  • 0
A Fast File System for UNIX

A Fast File System for UNIX

Ngày tải lên : 12/09/2012, 14:16
... fragments and a single unused fragment This remaining fragment can be allocated to another file as needed Space is allocated to a file when a program does a write system call Each time data is written to ... of a data transfer and the initiation of another data transfer on the same cylinder can be changed at any time, even when the file system is mounted and active If a file system is parameterized to ... the allocated space The problem with expanding a file one fragment at a a time is that data may be copied many times as a fragmented block expands to a full block Fragment reallocation can be minimized...
  • 14
  • 1K
  • 0
A web-based system for notifying environment violation.doc

A web-based system for notifying environment violation.doc

Ngày tải lên : 27/10/2012, 16:40
... 2.3.2.3 Data access tier It consists of the database server that contains all logic data of application Separating logic data from application into it will make program scalable and higher performance ... applications today use Relational Database Management System (RDBMS) using Structure Query Language (SQL) to store and manipulate data logic There are many available options to implement data ... operating system - Easy to manage, update database: Database is located at dedicated server that managers can maintain and update it easily - Quick delivery: web-based model make it portable to be...
  • 56
  • 410
  • 0
A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA

A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA

Ngày tải lên : 05/09/2013, 09:08
... official land used data obtained from SCAG land use data The pollutant loading maps of all water quality parameters show that the low pollutant emitting areas correspond to open land use due to its ... pollutant loads per unit pixel and unit rainfall for each water quality parameter i and α is a normalization factor that depends on units and conversion factors Table Runoff coefficient and EMCs for ... training data for the networks were collected using a random subset from all classes The total number of training data pixels was 4,000, which corresponds to 15% of total data All input data...
  • 7
  • 575
  • 0
Tài liệu A Knowledge Management System for ERP Implementation pdf

Tài liệu A Knowledge Management System for ERP Implementation pdf

Ngày tải lên : 16/01/2014, 16:33
... The application of new KM tools (KDD) are IT-based systems developed to support and enhance the organizational processes of knowledge creation, storage/retrieval, transfer, and application (Alavi ... interpretation, and reflection It is a high-value form of information that is ready to apply to decisions and actions’ (Albert and Baradley, 1997) Although there are sundry knowledge categories, the tacit-explicit ... stage Organization will carry out investment decision and cost–benefit analysis related to implementing ERP and select appropriate brand or vendor In the adaptation stage, the organization analyses...
  • 12
  • 622
  • 1
Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc

Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc

Ngày tải lên : 20/02/2014, 21:20
... propositions, and an adjective like further to take distances as its measure-specifier (as in thirty miles further) In fact, sortal constraints are assigned to every atomic predicate and operator appearing ... is that when they are formulated loosely, as in the previous paragraph, they appear to conflict In particular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a modifier ... syntax and semantics in this way depends on a crucial property of the semantics: a semantic interpretation is available for each syntactic node This is guaranteed by the semantic rule formalism and...
  • 8
  • 376
  • 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Ngày tải lên : 16/03/2014, 01:20
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... (5¢- to 3¢) GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG ... TTTTGAGCTCGGAGCCATAATGACAGCAGT TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
  • 9
  • 444
  • 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Ngày tải lên : 17/03/2014, 10:20
... Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. , Hatayama, T & Nagata, ... such as Hsp10 5a and Hsp70 in various mammalian cells Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells acquire transient resistance to a ... cyclooxygenase and nuclear factor-kappa B activation [9,10] In addition to the anti-inflammatory effects, it is noteworthy that SA which can activate HSF Ó FEBS 2003 Sodium salicylate is a potent...
  • 8
  • 470
  • 0
Lore: A Database Management System for Semistructured Data ppt

Lore: A Database Management System for Semistructured Data ppt

Ngày tải lên : 23/03/2014, 12:20
... standard operators such as Scan and Join, some take an original avor For example, Scan may take as argument a general path expression, and therefore may entail complex searches in the database ... 9: A DataGuide for Figure structure of an OEM database, stored itself as an OEM object Each possible path expression of a database is encoded exactly once in the DataGuide, and the DataGuide has ... complex and its subobjects are &8, &9, &10, and &11 Object &7 is atomic and has value Clark" Names are special labels that serve as aliases for objects and as entry points into the database In...
  • 13
  • 270
  • 0
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx

Ngày tải lên : 23/03/2014, 14:20
... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... Brockett, and William B Dolan 2004 Monolingual machine translation for paraphrase generation In EMNLP, pages 142–149 Shiqi Zhao and Haifeng Wang 2010 Paraphrases and applications In COLING (Tutorials), ... another language F , each translation could have m candidates {e } which may contain potential paraphrases for es Our task is to locate the candidate that best fit in the demands of paraphrasing...
  • 5
  • 347
  • 0
Báo cáo khoa học: "A Subcategorization Acquisition System for French Verbs" doc

Báo cáo khoa học: "A Subcategorization Acquisition System for French Verbs" doc

Ngày tải lên : 31/03/2014, 00:20
... Resources and Evaluation, volume IV, pages 1351–1357, Las Palmas de Gran Canaria, Spain Mihai Surdeanu, Sanda M Harabagiu, John Williams, and Paul Aarseth 2003 Using Predicate-Argument Structures for ... For more details of the lexicon and its format, see (Messiant et al., 2008) 3.3 Gold Standard Direct evaluation of subcategorization acquisition performance against a gold standard based on a ... NomFS|compagnie|compagnie|10|NOMPREP;8|DET;9 When aiming to build a large lexicon for general language, the input data should be large, balanced and representative enough Our system tags and lemmatizes input data using TreeTagger (Schmid,...
  • 6
  • 391
  • 0
báo cáo hóa học: "Introducing a feedback training system for guided home rehabilitation" potx

báo cáo hóa học: "Introducing a feedback training system for guided home rehabilitation" potx

Ngày tải lên : 19/06/2014, 08:20
... recorded data are additionally stored and can be examined off-line by the therapist to monitor the rehabilitation progress and interact by changing the training plan or give additional instructions to ... suitable for home rehabilitation training This is true for many other approaches as well [32-36] Page of 11 We therefore aimed to develop an easy to use, cheap and mobile training system that allows ... measured force values For all parameters, the mean values as well as the variances were calculated For evaluating the differences in the parameters among different groups, analysis of variance (double-sided...
  • 11
  • 524
  • 0
Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx

Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx

Ngày tải lên : 20/06/2014, 00:20
... years of practical experience and the limited time allowed for occupational medical examinations speak for a systematic subdivision of the physical examination into a screening phase and, based on ... for orthopaedic and manual diagnostics, here for reasons of efficiency and usability of the system in routine occupational medical examinations, the measures are chosen according to the situation ... relevance of tennis elbow symptoms For persons exposed to hand-arm vibration, it is recommended that particular attention be given to the maximum range of active and passive movement and to pain...
  • 10
  • 575
  • 0
Báo cáo hóa học: " Research Article CARNIVORE: A Disruption-Tolerant System for Studying Wildlife" docx

Báo cáo hóa học: " Research Article CARNIVORE: A Disruption-Tolerant System for Studying Wildlife" docx

Ngày tải lên : 21/06/2014, 11:20
... utilizes the MAC layer to send and receive data A single MAC layer task parses frames rapidly and updates the state variables for each task A neighbor table is maintained at each CSN that stores the ... behavioral and physiological data This data can be difficult to collect for predators that are hard to capture and time consuming to monitor directly Also, relatively rare but important events such as ... picks a data type to send If no data of any kind is available, the sender sends an end-of -data packet to terminate the transfer If the node has data to send, it fragments the 512-byte data segment...
  • 14
  • 378
  • 0
báo cáo hóa học:" Research Article A New Denoising System for SONAR Images" docx

báo cáo hóa học:" Research Article A New Denoising System for SONAR Images" docx

Ngày tải lên : 21/06/2014, 20:20
... coefficients at adjacent positions (intrascale dependence) and scales (interscale dependence) are modeled as the product of two independent random variables: a Gaussian vector and a hidden positive scalar ... NL-means algorithm tries to take advantage of the high degree of redundancy of any natural image Every small window in a natural image has many similar windows in the same image In a very general ... International Conference on Acoustics, Speech and Signal Processing (ICASSP ’01), Salt Lake City, Utah, USA, May 2001 [23] S Moga and A Isar, “SONAR image denoising using a Bayesian approach in the wavelet...
  • 14
  • 326
  • 0
Báo cáo hóa học: " A Multiple-Antenna System for ISM-Band Transmission" potx

Báo cáo hóa học: " A Multiple-Antenna System for ISM-Band Transmission" potx

Ngày tải lên : 23/06/2014, 01:20
... other approaches like fastICA [19] and SSARS [20] A Multiple-Antenna System for ISM-Band Transmission −1 0 In-phase −1 −1 −1 −1 Quadrature Quadrature 1 Quadrature Quadrature 1417 (a) In-phase ... In-phase Quadrature Quadrature Quadrature Quadrature 1 In-phase (b) −1 In-phase −1 −1 −1 −1 In-phase 1 Quadrature Quadrature The separation leads to data streams which are processed in the classical ... obtainable at small quantities, the digital buffer circuit is realized by a field-programmable gate array (FPGA) and static RAM (SRAM) In contrast to dynamic RAM, SRAM does not need refresh cycles and...
  • 13
  • 318
  • 0
Báo cáo sinh học: "he water flea Daphnia - a ‘new’ model system for ecology and evolution" potx

Báo cáo sinh học: "he water flea Daphnia - a ‘new’ model system for ecology and evolution" potx

Ngày tải lên : 06/08/2014, 19:21
... insect-crustacean sister-group relationship is mainly based on the comparative analysis of neural characters in higher crustaceans (malacostracans) and insects For example, in both insects and malacostracans, ... environmental samples - are sequenced and compared to the databases in order to characterize the biological community of a given habitat One of the advantages of this approach is the recovery of DNA sequences ... sexual and asexual reproduction most probably relate to mechanisms that differ between meiosis and mitosis, such as kinetochore orientation, DNA recombination and sister-chromatid cohesion, and...
  • 4
  • 318
  • 0
Vertical Shaft Plumbness Using a Laser Alignment System potx

Vertical Shaft Plumbness Using a Laser Alignment System potx

Ngày tải lên : 08/08/2014, 13:20
... thrust bearing data to make corrections on the thrust bearing, translation data to monitor the shaft position at the upper and lower guide bearings and tolerances to help determine when the shaft ... up and down the length of the shaft, or additional operators must be employed Once the readings are taken, data needs to be recorded accurately by the operator or the person in charge of evaluating ... be measured on the shaft and reduce the amount of time required to obtain measurements and perform corrections Laser- Based Plumbness Measurement Method The PERMAPLUMB® system is a laser based...
  • 11
  • 88
  • 0
Development of a liposomal nanodelivery system for nevirapine ppsx

Development of a liposomal nanodelivery system for nevirapine ppsx

Ngày tải lên : 10/08/2014, 05:21
... Pharmacological Sciences 2005, 26:2558-2264 13 Fiala M, Murphy T, MacDougall J, Yang W, Luque A: HAART drugs induce mitochondrial damage and intracellular gaps and gp120 causes apoptosis J Cardiovascular ... hydroxyapatite coated liposomes Biomaterials 2007, 28:2687-2694 50 Mickova A, Tomankova K, Kolarova H, Bajgar R, Kolar P, Sunka P, Plencer M, Jakubova R, Benes J, Kolanca L, Planka L, Necas A, Amler ... 39:81-103 Vyas SP, Rasika S, Jain S: Development and characterization of emulsomes for sustained and targeted release of antiviral agents to liver J Pharm Pharmacol 2006, 58:321-326 Amiji MM, Vyas TK,...
  • 9
  • 359
  • 0

Xem thêm