0

a jframe gui for manipulating files

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

Tiến sĩ

... TTTTGCGGCCGCCMNNMNNMNNGCAGCAGCCGGGGCAGCA AATACGACTCACTATAGGGA GTAATCCAGAGGTTGATTCTCGAGAAAA TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC ... 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGCGGCCGCTTAAGAACCGC 14 AAACTCGAGTTAGCGGCCGCCCCTCCACATGCAG 15 AAAGCGGCCGCCAGAACCGCAGCACCCGGGGCA 16 TTTGCGGCCGCATGGATGATGATATCGCCGCG 17 TTTCTCGAGCTAGAAGCATTTGCGGTGGAC ... TTTCTCGAGCTAGAAGCATTTGCGGTGGAC 18 CTCAGATCTCGGGCTATGGATGATGATATCGCCGC 19 TCGAGATCTGAGTCCGGACTTGTACAGCTCGTCCATG 20 TTTAAGCTTGCCACCATGGATTACAAGGATGACGACGATAAGGGATCCGCCGGAT CCTTTTTGAATTG 32 Table 1.2 Continued 21 TTTAAGCTTGCCACCATGGTGTACCCCTACGACGTGCCCGACTACGCCGGATCCG...
  • 144
  • 306
  • 0
CGrand Challenges:  A Strategic Plan  for Bridge Engineering

CGrand Challenges: A Strategic Plan for Bridge Engineering

Kiến trúc - Xây dựng

... of statistical databases for LRFD calibration, e.g maintenance, operations and geotechnical databases Development of performance standards for security Completion and adoption state-of-the-art ... professional training (including practices, materials and policies) Development of educational materials (materials appropriate to undergraduate education as opposed to available professional education ... be warranted Additionally, there are areas of the specification that are currently undergoing major revision A new conditional evaluation manual including the load and resistance factor rating...
  • 21
  • 1,073
  • 0
Báo cáo y học:

Báo cáo y học: "High-Resolution Flow Cytometry: a Suitable Tool for Monitoring Aneuploid Prostate Cancer Cells after TMZ and TMZ-BioShuttle Treatment"

Y học thưởng thức

... Ishihara M, Kamiya N, Komiya A, Shimbo M, Suyama T, Sakamoto S, and Ichikawa T Bisphosphonate and low-dose dexamethasone treatment for patients with hormone-refractory prostate cancer Hinyokika ... (brachytherapy) [7] iv) The standard initial systemic therapy for locally advanced or metastatic disease is hormonal or androgen deprivation therapy (ADT) that may be performed by bilateral orchiectomy ... 84-90 Stathopoulos GP, Koutantos J, Vaslamatzis MM, Athanasiadis A, Papadopoulos G, Labrodimou G, Stathopoulos J, and Rigatos S Survival after cytotoxic chemotherapy in patients with advanced hormone-resistant...
  • 10
  • 408
  • 0
Báo cáo y học:

Báo cáo y học: "Rasburicase represents a new tool for hyperuricemia in tumor lysis syndrome and in gout Lisa Cammalleri and Mariano Malaguarnera"

Y học thưởng thức

... hyperuricemia [21-24] Contemporary use of alkalinization, hydration and rasburicase at 0.10 mg/kg for 3-5 days maintains the same efficacy [25] Anyway, we may have favourable issues by changing the ... prevent and treat hyperuricemia include allopurinol and alkalinization, associated with an aggressive hydration Rasburicase presents various features that give it a more favourable profile than standard ... because each metabolic derangement is associated with remarkable clinical manifestations Hyperuricemia and hyperphosphatemia severely worsen renal functionality; hyperkalemia and hypocalcemia...
  • 11
  • 715
  • 0
Some studies on a probabilistic framework for finding object-oriented information in unstructured data

Some studies on a probabilistic framework for finding object-oriented information in unstructured data

Công nghệ thông tin

... chapter: Generative and Discriminative classifiers McGraw-Hill, New York www.cs.cmu.edu/tom/newchapters.html [22] T S Jayram, Rajasekar Krishna-murthy, Sriram Raghavan, Shivakumar Vaithyanathan, ... challenges about scalability and adaptability of the previous approaches We have then adapted the probabilistic framework to a Vietnamese domain - real estate In practical, the results increased of ... to obtain the desired information in an efficient and direct manner Currently, there is a lot of information available in structured format on the web For example, an apartment on real estate website...
  • 51
  • 393
  • 0
academic-writing-a-practical-guide-for-students

academic-writing-a-practical-guide-for-students

... extract is an example of academic register, used, for instance, in dissertations and academic journals This typically uses cautious language like apparent and often, as well as academic vocabulary ... ‘There are so many strains of malaria parasite,’ said one scientist, ‘and each is able to alter its chemical surface and trick its way past the body’s defences We’d need a remarkable vaccine ... topics are examined and compared, one after another c) For and against – the advantages and disadvantages of two systems are discussed Complete the plan for the title in (1) using ideas from (1) a) ...
  • 200
  • 791
  • 24
A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI   by   Dinh Huu Son

A WEB APPLICANTION FOR THE TOURISM INDUSTRY IN HANOI by Dinh Huu Son

Báo cáo khoa học

... transmission of payment transaction data, and associated remittance advice data, from a payee to their bank, for onforwarding (via banks and/or value-added network operators) to the payee's bank ... can spare or days, you are advised to visit Vientiane, Laos capital with legendary pagodas such as Srisakhet Hortakeo, Thatluang From Hanoi, many interesting tours are available because they are ... professional editor for creating and managing Web sites and pages Because it incorporates all of Dreamweaver's page design and site management tools, UltraDev makes it easy to create, manage, and edit...
  • 58
  • 472
  • 0
a decentralized approach for implementing identity management in cloud computing

a decentralized approach for implementing identity management in cloud computing

An ninh - Bảo mật

... a hybrid misuse-anomaly detection approach to take advantage of anomaly detection’s ability to detect new attacks, but without the approach’s accompanying high rate of false positives There are ... anomaly behavior or not As demonstrated in [11], a basic assumption of anomaly detection is that attacks differ from normal behavior But the definition of what’s normal and what’s abnormal is ambiguous ... bottleneck of the performance of the cloud III Virtualization as an indispensable ingredient for almost every cloud realizes the abstraction that all the applications appear to the users as if they were...
  • 7
  • 589
  • 0
a rapid method for estiminating of noise expouse workplace

a rapid method for estiminating of noise expouse workplace

Môi trường

... Checklist and SPAN in Veterans Affairs primary care settings (16) In this study, the positive predictive value was 25 Golmohammadi R et al: A Rapid Method for 62.5% and negative predictive value as ... Less than years Quality of maintenance of equipments Suitable Little suitable Unsuitable Rotation and duration of noise produce noise sources All of shift Half of a shift Less than a half shift ... sensitivity and specificity are usually inversely related (15) Any other studies had similar results for specificity to obtain a reliable test for screening Sadri and Mahjub gave a low sensitivity...
  • 7
  • 418
  • 0
Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

Novel design of a compacted micro-structured air-breathing PEM fuel cell as a power source for mobile phones

Môi trường

... can be seen that for a high nominal current density, a high fraction of the current is generated at the catalyst layer near the air inlet area, leading to under-utilization of the catalyst at ... 0) and condensation ( m phase < 0) is assumed Where m phase is mass transfer: for evaporation & & & & ( m phase = mevap ) and for condensation ( m phase = mcond ) (kg/s) So that the mass balance ... Kelvin near the catalyst layer regions, where the electrochemical activity is highest The temperature peak appears in the cathode catalyst layer, implying that major heat generation takes place in...
  • 18
  • 549
  • 0
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry

Môi trường

... fatty acids and fatty alcohols, sterols and alkanes Natural waxes have a wide range of industrial uses in cosmetics, polishes and coatings, pharmaceuticals, and insecticides Wheat straw contains ... acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature (50 °C) which capital ... temperature steam or water with or without acid catalyst During the pretreatments, internally produced acids also serve as a catalyst (“autohydrolysis”) Acid catalyzed hydrolysis and partial degradation...
  • 20
  • 437
  • 0
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

Môi trường

... pp.927-938 935 (a) Best, mean and median objective valuses for Case I (b) Standard deviations for Case I (c) Best, mean and median objective values for Case II (d) Standard deviations for Case II Figure ... optimization for VAWT wind farm The results are given in Table The optimal layout is the same as that of a HAWT as shown in Figure Table Optimization results for VAWT wind farm Optimization Objective ... Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, the size of the farm is...
  • 12
  • 635
  • 1
Writing a Property List for Management

Writing a Property List for Management

Phần cứng

... each tab are managed separately and that you’ll need to select ‘‘Always’’ again Enable the check box for ‘‘Automatically Show and Hide the Dock’’ and click ‘‘Apply.’’ There! You just wrote a ... otherwise) Additionally, there are many non-Apple preferences that you may want to manage Thankfully, Apple did include a way to handle this As mentioned in Chapter 4, preferences are part and parcel ... to read one single attribute from a record Specify the attribute after the record name: $ dscl /Local/Default read /Users/marczak RealName RealName: Edward R Marczak The dscl command can also...
  • 17
  • 343
  • 0
Conventional Providing a Uniform Law for Bill of exchange and Promissory Notes

Conventional Providing a Uniform Law for Bill of exchange and Promissory Notes

Kỹ năng bán hàng

... drawer may prohibit presentment for acceptance He may al so stipulate that presentment for acceptance 75 shall not take place before a named date Unless the drawer has prohibited acceptance, every ... has a direct action on the bill of exchange against the acceptor for all that can be demanded in accordance with Articles 48 and 49 Article 29 Where the drawee who has put his acceptance on a ... payable at the address of a 74 third party or in a locality other than that of the domicile of the drawee, or, except in the case of a bill drawn payable at a fixed period after sight, the drawer...
  • 37
  • 673
  • 0
The PERFORMANCE APPRAISAL QUESTION and ANSWER BOOK: A SURVIVAL GUIDE FOR MANAGERS

The PERFORMANCE APPRAISAL QUESTION and ANSWER BOOK: A SURVIVAL GUIDE FOR MANAGERS

Kỹ năng quản lý

... Appraisal 1.1 What is ‘‘performance appraisal’’? Performance appraisal is a formal management system that provides for the evaluation of the quality of an individual’s performance in an organization ... be hauled off to court for discrimination Although it’s easy to poke fun at performance appraisal (and the way performance appraisal is carried out by many managers and many organizations makes ... individual’s performance thus far against the plans and goals that they discussed in the performance-planning meeting Phase 3: Performance Assessment As the time for the formal performance appraisal...
  • 255
  • 852
  • 5
A general framework for studying class consciousness and class formation

A general framework for studying class consciousness and class formation

TOEFL - IELTS - TOEIC

... ``weak'' class formations; unitary or fragmented class formations; revolutionary, counterrevolutionary or reformist class formations Typically, class formations involve creating formal organizations ... consciousness and class formation, but rather as a framework for de®ning an agenda of problems for empirical research within class analysis In the multivariate empirical studies of class consciousness and ... interests All things being equal, class formations that link locations with relatively similar material interests are thus easier to create than class formations that link locations with quite disparate...
  • 31
  • 500
  • 0
Tài liệu ADC KRONE - Guide - FTTP - A Deployment guide for Network Manager docx

Tài liệu ADC KRONE - Guide - FTTP - A Deployment guide for Network Manager docx

Kỹ thuật lập trình

... mythical “seamless” network may have appeared as a good solution for transport and backhaul operations, but with an access network, the ability to easily test and monitor is essential Without seams ... What span lengths are there to be met? • What flammability standard is required? • What is the attachment hardware preference? • What sheath access tools are required? • What are the bonding and ... discrepancies between the asset-management database and the actual inventory, including: • Upgrades to passive and active network equipment elements • Space reclamation as higher-density fiber frames...
  • 21
  • 468
  • 0
Tài liệu De-interlacing A Key Technology for Scan Rate Conversion doc

Tài liệu De-interlacing A Key Technology for Scan Rate Conversion doc

Cao đẳng - Đại học

... nowadays Although the literature provides evidence that an all-progressive chain gives at least as good an image quality as an all-interlaced chain with the same channel bandwidth, recent research ... visual information Until a few years ago, digital image communication research was still confined to universities and research laboratories of telecommunication or broadcasting companies Nowadays, ... storage media Moreover, personal computers and workstations have become important platforms for multimedia interactive applications that advantageously use a close integration of digital compression...
  • 369
  • 428
  • 0

Xem thêm