a hierarchical approach to the evaluation of variability in ecoindicators of the seagrass thalassia testudinum
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... substantially to the 554 nm absorbance Although not fully linear and saturating with increasing cytochrome content, the heme staining experiments are indicative of the fact that these cytochromes...
- 11
- 731
- 0
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... complicated example: Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating ... morphological processing to encode these notions We view the parsing system as a partial but general theory of morphological processing, and the work we have done on Warlpiri as a particular instantiation ... spanning the input In the example case, we have a lattice with a unique path comprising VerbalReduplication, pangi, rnu We now wish to check that, from a phonological point of view alone, the affixes...
- 8
- 522
- 0
Báo cáo khoa học: "A New Approach to the Mechanical Syntactic Analysis of Russian" ppt
... Its phrase number (P), and A Backward Flag (b) to indicate a particular manner in which the string is to be handled during the process of syntactic integration In the event that the routine does ... resolved at present For the remaining polysemantic words, we are forced to print out all the meanings contained in our glossary The chart incorporates all of the steps entailed in carrying out the ... is planned to expand this information to include diacritical material designed to aid in the semantic analysis of the sentence.) PART I Our program is being coded in two parts Of these only the...
- 18
- 701
- 0
Báo cáo khoa học: "A Computational Approach to the Automation of Creative Naming" ppt
... generated are eatalian (from the combination of eat and Italian), pastarant (pasta + restaurant) and peatza (pizza + eat) These three suggestions are amusing and have a nice ring to them As a matter ... computational study in the literature that can be applied to the automatization of name generation Stock and Strapparava (2006) introduce an acronym ironic reanalyzer and generator called HAHAcronym ... solutions, automatic name generı ators can be used as a source of inspiration in the brainstorming phase to get ideas for good names As an example, www.business-name-generators com randomly combines abbreviations,...
- 9
- 518
- 0
Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx
... detected in both the initial fricative and the final plosive at Stage Again, it may be possible to identify a unique word candidate at the end of Stage 2, but if several candidates are available, ... which can be built on the basis of manner-class information alone and checks its conformance to the universal principles of grammar in GP as well as to languagespecific constraints In cases of conflict ... traditional ASR applications (e.g dictation, database access), but also embraces multilingual speech input, medical (speech therapy) and teaching (computer-assisted language learning) applications...
- 5
- 337
- 0
jesus our priest a christian approach to the priesthood of christ apr 2010
... into their language of salvation for all human kind and the expiation of their sins and say more about what his priesthood effected in bringing about a new covenant (2, 5, and 6)? What does the ... presented by the Father [on the cross] as a means of expiating or wiping away the sins of humanity, indeed, as the place of the presence of God, of his revelation, and of his expiating power’.9 ... or cover and you must impose the same condition on any acquirer British Library Cataloguing in Publication Data Data available Library of Congress Cataloging in Publication Data Library of Congress...
- 322
- 436
- 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc
... EURASIP Journal on Advances in Signal Processing and secondly using the fact that in case of real-valued signals the real part in frequency domain corresponds to the even part in the time-domain ... that the region defined by the upper inequality constraint is convex due to the linearity of the left term in h Please note that the number of constraints in the stopband in the original formulation ... EURASIP Journal on Advances in Signal Processing delay can always be obtained that ranges below the group delay of a corresponding LP FIR filter However, the absolute minimum value of the passband...
- 13
- 623
- 0
Báo cáo hóa học: " Research Article RRES: A Novel Approach to the Partitioning Problem for a Typical Subset of System Graphs" potx
... (iv) the totalised values for area Atotal , Stotal , and time Ttotal ; the time based degree of parallelism γt the ranks of all vertices; the density ρ of the system graph These values can be achieved ... rank levels are annotated at the bottom of the graphic The fundamental idea of the algorithm explained in Section is that, in general, a local optimal solution, for instance, covering the rank ... is therefore straightforward and rather trivial To be in accordance with most of the partitioning approaches in the field, we assume a graph representation to be in the form of synchronous data...
- 13
- 310
- 0
Báo cáo hóa học: " Research Article A Variational Approach to the Modeling of MIMO Systems" docx
... However, there is a clever way to extract information from this matrix without going into involved mathematical analysis The idea is to optimize the above scattering equation using a variation approach ... for instance, Appendix A. 2 and [8–10] 3.1.1 Variational channel equation Instead of modeling the channel by the typical scattering equation (4), we propose to rather use the following variational ... the analysis of [15] and borrowing ideas from particles scattering theory of quantum mechanics [8–10], we develop, in the first part of this section, a way to approach H using the random variable...
- 10
- 548
- 0
Báo cáo toán học: "A probabilistic approach to the asymptotics of the length of the longest alternating subsequence" pdf
... a, and let s1 , , sr′ be the positions, in increasing order, of the local minima of a, not including the local minima before the position t1 Notice that the maxima and minima are alternating, ... combinatorics 17 (2010), #R168 manner to this context, so that LAn (a) = # local maxima of a + # local minima of a n−1 = (a has a local maximum at n) + (a has a local maximum at k) k=1 Now, the ... ≤ ak+1 k Then, for any bilateral sequence a ∈ [q]Z , we have a( n) has a local maximum at k = (a has a local maximum at k) + 1Ak (a) , if k < n, and a( n) has a local maximum at n = (a has a local...
- 19
- 428
- 0
Báo cáo y học: " Control of allergic rhinitis and asthma test – a formal approach to the development of a measuring tool" ppt
... round, facilitated the data gathering and analysis, while maintaining anonymity of the answers (for further details see Additional file 1) In the first round, each participant was asked to choose ... [http://www.biomedcentral.com/content/supplementary/14659921-10-52-S1.doc] Manuel Branco Manuel Luciano Margarida Trindade Rita Câmara Rodrigo Alves Additional file CARAT – Control of Allergic Rhinitis and Asthma Test This is a translation to English of the of the ... participants in the Final meeting of the Formal Consensus Process Ana Arrobas Ana Todo-Bom Ângela Gaspar Aurora Carvalho Carlos Alves Carlos Lopes Fernando Calvário Authors' contributions LNS participated...
- 9
- 370
- 0
Báo cáo y học: "Nebulised heparin: a new approach to the treatment of acute lung injury" pdf
... remains to be done The following questions need to be answered As the pro-coagulant state in the alveolar space begins in the early phases of ALI, how can it be assessed in order to initiate ... Critical Care Vol 12 No Suter The translation of a potentially beneficial effect of inhaled heparin in experimental models of ALI to clinical practice has not yet been achieved; important additional ... heparin administration as rapidly as necessary? How can dosage of the drug be titrated to achieve maximal local effects without the risk of systemic complications? What is the adequate duration...
- 2
- 350
- 0
A markovian approach to the analysis and optimization of a portfolio of credit card accounts
... be the index of the past applications The range of i covers the whole training set of applications derived from past data Applicant i can either belong to the class of “goods” or to the class of ... by increasing the penalization factor The novel approach to include either the attrition phenomenon or the bankruptcy filings is based on the embodiment of either of these stochastic variables in ... and then in each yes (no) category to compute the ratio between the probability of being “good” and the probability of being “bad” Such ratio is then the value of the variable associated to the...
- 184
- 497
- 0
Tài liệu Báo cáo khoa học: "A PROBABILISTIC APPROACH TO GRAMMATICAL ANALYSIS OF WRITTEN ENGLISH BY COMPUTER" pot
... endeavoured to apply similar techniques to provide a constituent analysis It is the task of the final phase of the parser to fill in any remaining closing brackets in the appropriate places and ... so that, for instance, in fact is labelled as a prepositio'~aT-~rase rather than as an adverbial phrase No attempt is made to show any paraphrase relationships Putative deleted or a 161 either ... encountered by the linguist in providing a satisfactory grammatical analysis of the constructions in the corpus The rationale for the original set of rules and symbols, and of subsequent modifications,...
- 7
- 529
- 0
Báo cáo khoa học: "A Bootstrapping Approach to Unsupervised Detection of Cue Phrase Variants" docx
... difficulty of finding negatives contexts, essential in bootstrapping to evaluate the quality of the patterns automatically IE and QA approaches, due to uniqueness assumptions of the real-world relations ... Human evaluation We next perform two human experiments to indirectly evaluate the quality of the automatically generated cue phrase variants Given an abstract of an article and a sentence extracted ... concept-B accumulator list (based on empirical results, s is the rank of the candidate set during the initial iteration and 50 for the remaining iterations) If an item is already on the accumulator...
- 8
- 499
- 0
Báo cáo khoa học: "A Hierarchical Approach to Encoding Medical Concepts for Clinical Notes" docx
... Categorization Framework In a hierarchical text categorization system, categories are linked together and classifiers are assigned to each node in the taxonomy In the training stage, instances are ... tree as the negative ones This hierarchical approach of distributing training instances can reduce the size of training data set for most classifiers and minimize the data imbalance problem for ... training a classifier for a node A in the tree, all the instances in the subtree rooted in the parent of A become the only source of training instances For instance, code ‘786.0’ in Figure uses all the...
- 6
- 367
- 0
Báo cáo toán học: "A New Approach to the Dyson Coefficients" doc
... (a1 − 1) n = a1 a1 aj a1 a2 a1 aj − − + + a − a1 a( a − a1 ) j=3 (1 + a − a1 )(1 + a − a1 − aj ) a( a − a1 ) = a1 a1 a2 a1 (a − a1 − a2 ) a1 aj − − − Cn (a) + a − a1 a( a − a1 ) a( a − a1 ) (1 + a ... j=1 a1 + aj − a1 aj − aj − − Cn (a) + a − a1 − aj a − a1 + a − aj a a1 + aj a1 aj − − − Cn (a) + a − a1 − aj + a − a1 + a − aj a1 aj a1 aj =− + Cn (a) (1 + a − a1 )(1 + a − a1 − aj ) a( a − a1 ... a − a1 − aj )k! a2 ! · · · an ! kaj (a − a1 + k)! (1 + a − a1 )(1 + a − a1 − aj )k! a2 ! · · · an ! by (2.1) for the case n = a1 and m = a − a1 kaj (a − a1 + k)! (1 + a − a1 )(1 + a − a1 − aj...
- 6
- 370
- 0
Báo cáo y học: "A genomic approach to investigate developmental cell death in woody tissues of Populus trees" pot
... POPLAR.11646, TGAACAGCAGGAGGTGTGAG and AACAGGTGTCCCCATCTGAG for POPLAR.11624, and TGGCAACTCCAATGAAGAAC and CACCAACAGTTTATTTATTATTCAGATG for POPLAR.9335 Analysis of proteases in the POPULUSDB A ... POPLAR.11628, CAGGAAAGCTCTCCGTTTCTT and TCAAAGCTCTTCCCTTCTGC for POPLAR.11658, AATCCCATGAATATTACCCCTAGA and TCTCTTGCATGGGTAGACATTTT for POPLAR.11639, ACCTCCATAGCCACCCAAG and CTGCAAGCTGATGCAGAAGT ... singletons(fiber-cell ESTtotowereof Arabidopsisand4GenBankat thedata Theexpression sampleanalysis particularaccession(s) and Thetwo ratioannotationsArabidopsis and death(Bayesian (A) .fortotranscriptsaccordingcalculated...
- 14
- 299
- 0
A combinatorial approach to the search for anticonvulsant agents from gou teng and tian ma
... number of rings in the structure, pentacyclic oxindole alkaloids (POA) and tetracyclic oxindole alkaloids (TOA) Wurm et al 35afound that it was the POA instead of the TOA that induced human endothelial ... proposed as potential antagonistic effect at Gly/NMDAR 38 EMS scans for peak in TIC of the alkaloidal extract 46 Total ion chromatogram (TIC) of the alkaloidal extract (A) ; UV spectrum of the alkaloidal ... the fraction as a means of quality control, it would be too premature to regard it as an alkaloidal fraction since probably only a minor part of the extract was alkaloidal with non-alkaloidal constituents...
- 195
- 529
- 0
A metabolomics approach to understand mechanism of heat stress response in rat
... significantly increases the esophageal temperature triggering thermoregulatory sweating, but that the sensitivity and maximum sweating rate are maintained at normal levels relatively well (Washington ... laboratories can be shared, leading to construction of standard databases However, the limitations as to the size and types of metabolites that can be analyzed and the extensive preparation and ... or handling has increased the validity of the rat as a model for human heat acclimation Better understanding of heat stress mechanism and metabolism in rat can eventually help in better management...
- 120
- 468
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25