a granuphilin a in dense core vesicle exocytosis
Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc
... Dikeakos et al is autocatalytically cleaved, a central catalytic domain comprising the catalytic triad of amino acids aspartic acid, histidine and serine, and a stabilizing P-domain involved in ... constitute the baseline for analyzing potential granule-sorting domains Attachment of the entire 228 amino acid C-terminal tail of PC5 ⁄ 6A to the Fc fusion protein causes a significant increase in its ... the native proteins a- Helical sequences involved in sorting proteins to secretory granules have also been observed in other proteins: prosomatostatin contains an a- helix in its N-terminal region...
- 9
- 600
- 0
Báo cáo khoa học: Identification of a novel inner-core oligosaccharide structure in Neisseria meningitidis lipopolysaccharide docx
... glucitol, glucosaminitol and L-glycero-D-manno-heptitol in approximately equimolar ratios O-Deacylated LPS (LPS-OH) from all strains was prepared by hydrazinolysis, and initial analyses were carried out ... were also observed for strains 425/93 and 1000 (Table 1) Core oligosaccharide from the 1000 galE mutant strain was also prepared and examined by MS A range of molecular masses was found for the core ... lipid A (Lipid A- OH) is as indicated Lipid A- OH consists of two glucosamine residues each bearing an N-linked 3-OH C14:0 fatty acid and a phosphate group Variation in lipid A- OH sizes observed are...
- 8
- 361
- 1
Báo cáo hóa học: " A Facile Strategy for In Situ Core-Template-Functionalizing Siliceous Hollow Nanospheres for Guest Species Entrapment" potx
... Benjamin, Z Miklos, Acta Biomater 4, 733 (2008) 38 M Fujiwara, K Shiokawa, K Hayashi, K Morigaki, Y Nakahara, J Biomed Mater Res Part A 8 1A, 103 (2007) 39 M Fujiwara, K Shiokawa, I Sakakura, Y Nakahara, ... polyacrylate sodium (30 wt%, average Mw *2.5 KDa) (abbreviated as PAS2.5) and poly(aspartic acid) (30 wt%, average Mw *5.0 KDa) (abbreviated as PAsp5), gelatin (alkalic-processing; 10 wt%, average ... Specifically, polyacrylate, polyaspartate and alkaline-processed gelatin molecules containing COOgroups are initially selected because of their biocompatible and noninflammatory nature, and especially...
- 7
- 302
- 0
Tài liệu Vietnam-Netherlands Programme for M.A. in Development Economics pdf
... impact of an import quota on foreign cars? What will be the impact of an increase in the gasoline excise tax? Chapter 1: Preliminaries Slide 13 Positive versus Normative Analysis Normative Analysis ... benefit of individuals, organizations and economy A different perspective: Economics as a science studying markets (James Buchanan) Chapter 1: Preliminaries Slide Preliminaries Starting point of ... aggregate measure Real prices are emphasized to permit the analysis of relative prices Chapter 1: Preliminaries Slide 20 Real Versus Nominal Prices Calculating Real Prices Real Price = (base year...
- 25
- 513
- 1
Tài liệu Báo cáo khoa học: Phosphorylation of hormone-sensitive lipase by protein kinase A in vitro promotes an increase in its hydrophobic surface area ppt
... and that this is followed by an interaction between the apolar acyl chains of the phospholipids and side chains of particular amino acids, thus accounting for the increased capacity to penetrate ... that HSL gains accessible hydrophobic surface area upon PKA phosphorylation This gain in hydrophobic surface area presumably accounts for the increase in in vitro activity of HSL following PKA ... purification of C-terminal His-tagged recombinant rat adipocyte HSL To generate a recombinant baculovirus encoding C-terminally tagged rat adipocyte HSL, full-length rat adipocyte HSL cDNA, including...
- 11
- 562
- 0
Tài liệu Báo cáo khoa học: Mitochondrial targeting of intact CYP2B1 and CYP2E1 and N-terminal truncated CYP1A1 proteins in Saccharomyces cerevisiae ) role of protein kinase A in the mitochondrial targeting of CYP2E1 pdf
... conserved among mammals and yeast [24,25] As protein trafficking has been very well characterized in budding yeast and is thought to involve a similar translocation mechanism as that in mammalian cells, ... enzymes in endogenous signalling pathways and environmental carcinogenesis Nat Rev Cancer 6, 947–960 Addya S, Anandatheerthavarada HK, Biswas G, Bhagwat SV, Mullick J & Avadhani NG (1997) Targeting ... Anandatheerthavarada HK, Bhagwat SV, Biswas G, Fang JK & Avadhani NG (2000) Accumulation of mitochondrial P450MT2, NH(2)-terminal truncated cytochrome P450 1A1 in rat brain during chronic treatment...
- 16
- 650
- 0
Tài liệu POST GRADUATE SYLLABUS: MASTER OF ARTS (M.A) IN ECONOMICS doc
... 2: Data Processing, Techniques and Algorithms Concept of data, record and file; Types of data and data structures, data analysis; File handling and, appending and cascading, closing and attribute ... Recommendations -Recent Budgets (2 to years)- Parallel Economy-– Financial System, Banking and Insurance – Capital markets -Critical Appraisal of Monetary and Financial Sector Reforms – Financial Inclusion- ... Roy Scaria ,Govt College, Koothattukulam Dr.Mothy George ,Maharaja's College, Eranakulam Mr.Joby Jose ,Maharaja's College, Eranakulam Dr.Muralidharan ,Retd Prof.,Maharaja's College, Eranakulam(External...
- 102
- 539
- 0
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx
... Glc1-Man9-GlcNAc2 [5] Consequently the protein can bind to calnexin ⁄ calreticulin again and remains in the ER This loop can be repeated several times and may enhance the chances of a protein folding ... proteasome, leupeptin (Lp) is an inhibitor of cysteine and serine proteases, and okadaic acid (OA), phenylarsine oxide (PAO) and sodium orthovanadate (SOV) are phosphatase inhibitors The latter ... order to investigate the degradation pathway of amino acid-substituted ASAs in the ER, we used Ltk– 1181 Arylsulfatase A degradation cells which stably express the ER-retained ASA mutant enzymes...
- 10
- 504
- 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt
... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... mutants of A thaliana are already available [26] We were able to obtain one T-DNA insertion line each for AtRPA7 0a and AtRPA70b (Fig 1A) The T-DNA insertion in AtRPA7 0a (atrpa7 0a) was lethal, ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC2–5 and Rad9–Rad1–Hus1)...
- 12
- 588
- 0
Báo cáo khoa học: Identification and characterization of B¢¢-subunits of protein phosphatase 2 A in Xenopus laevis oocytes and adult tissues Evidence for an independent N-terminal splice variant of PR130 and an extended human PR48 protein pot
... 107 2850 AACGAGgtaggc ATCAAGgtaaga ACACAGgtttga GCAAAGgtaatg GAGAAAgtaagt CTTCAGgtaatt ACCACGgtaggc TTGCAAgtatgc ACCAGGgtaagt AACAAGgtaaga TACCAGgtatga TTGATGgtgaga CAGAAGgtaaca GGAAGGgtgagt 35209 ... 70034 ttacagGTTTCT ctgcagGCTGTG ttttagATTCAA ttgcagGTCTGT ttatagGTTGCT tttcagGATGTG aaccagGTTATT tttcagACCCTA atttagCTTCAT ctttagGGGAAA atctagCATTGA atgtagGCAAAA aatcagGATGTT tttcagCTTTGA gene ... 5¢-GTTCCTGAGCAAAGTCTTCAATG-3¢ and 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and the primers 5¢-GGAATTCATGCCGACCACAACCGTT TTAAG-3¢ and 5¢-GGAGACAGTGACAAGTTATCTA GTGCT-3¢ for XPR70 PCR products were resolved on a...
- 12
- 507
- 0
Báo cáo khoa học: Regulation of DNp63a by tumor necrosis factor-a in epithelial homeostasis docx
... 5¢-TGACATGTTTTCTGACGGCAA C-3¢; Bax reverse, 5¢-GGAGGCTTGAGGAGTCTCACC-3¢; DNp6 3a forward, 5¢-GGAAAACAATGCCCAGACTC-3¢; DNp6 3a reverse, 5¢-GTGGAATACGTCCAGGTGGC-3¢; GAPDH forward, 5¢-GAAGGTGAAGGTCGGAGTC-3¢; ... TCTCCGTCAGTG-3¢; Noxa forward, 5¢-GAGATGCCTG GGAAGAAGG-3¢; Noxa reverse, 5¢-ACGTGCACCTCCT GAGAAAA-3¢; p21 forward, 5¢-AAGACCATGTGGAC CTGT-3¢; p21 reverse, 5¢-GGTAGAAATCTGTCATGC TG-3¢; Bax forward, ... TRADD–FADD–procaspase complex and activate the apoptotic signaling cascade TNFRI can also activate other signaling cascades, including the JNK pathway To determine whether NF-jB or JNK signaling is involved in...
- 12
- 452
- 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
... the manufacturer GTATTCAAAAGTGGTCCCGGACAAAATGAGGACTTG TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC CATTTTGTCCGCCAAGACTTTTGAATACTTTCAAGTGC CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG ... CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG CCTCATTTCCTCCGGGAAGACTTTTGAATAC CGGACAAGGTGAGGACTTGGTACTTACTGGATAC CAAGTCCTCACCTTGTCCGGGAAGACTTTTG Proteases Papain (EC 3.4.22.2) was purified, stored as inactive S-(methylthio)papain ... Asn77) to protease binding (see Fig 1A) Four recombinant cystatin A variants with Gly replacing each of these amino acids were prepared, and their interaction with papain, cathepsin L, and cathepsin...
- 10
- 533
- 0
JavaScript: A Crash Course – Core Language Syntax pdf
... functions are in radians • Functions – Math.abs, Math.acos, Math.asin, Math.atan, Math.atan2, Math.ceil, Math.cos, Math.exp, Math.floor, Math.log, , , p, , g, Math.max, Math.min, Math.pow, Math.random, ... = 6; printArray1(names); printArra 1(names) printArray2(names); } function printArray1(array) { for(var i=0; i
- 28
- 318
- 1
Báo cáo khoa học: Induction of PAI-1 expression by tumor necrosis factor a in endothelial cells is mediated by its responsive element located in the 4G/5G site ppt
... MT-IjBa, which cannot be phosphorylated at Ser32 and Ser36, resulted in a substantial decrease in TNFa-induced PAI-1 expression and promoter activity These findings indicate that signaling pathways ... Painter CA, Covington JW, Dixon JD, Schoenhard JA & Vaughan DE (2004) Tumor necrosis factor alpha activates the human plasminogen activator inhibitor-1 gene through a distal nuclear factor kappaB ... other acute-phase reactants, which implies that the increases in these reactants are secondary to the increase in PAI-1 [27] Our data show that activation of endothelial cells with TNFa to produce...
- 11
- 393
- 0
Anh văn lớp 7 - Unit five: Work and play A/ In class (A1) docx
... science -Be interested in -Do experiments -map Call some students and ask them to read it again Read after the teacher Listen and correct their mistakes Ask the questions for each picture Have students ... questions: Answer these questions: -What school does Mai go? -Mai goes to Quang Trung school -How many days a week does Mai -Six day a week go to school? -At 7/ At a quarter past seven -What time classes ... Listen, look at the pictures and read pictures and read the captions under after the tape the each picture while listening the tape Ask them to find the new words and Find the new words explain these...
- 4
- 730
- 3
Anh văn lớp 7 - Unit five: Work and play. A/ In class. (A2) pps
... read a passage about Ba two 2, Presentation and tell me what the main idea of the Read a passage and find the main passage is idea of the passage Have the students read the passage Go around to help ... pictures and introduce about them: He is learning how to repair a This is Ba , tell me what he is doing socket board in picture one, and he is playing the guitar in the picture Now you read a passage ... Call some students and ask them to read again the text to check those Read again the text answers Give the vocabulary: enjoy, Electronics, household appliances, Read these vocabulary fix= repair,...
- 4
- 889
- 2
Anh văn lớp 7 - Unit five: Work and play. A/ In class ( A3+ A4) pot
... Geography, Physical Education What are the pictures about? The aim of the listening: What subjects Ba and Lan study on Listen the tape carefully Saturday morning? Play the tape, check the keys after ... ask he/ she to read again the conversation *How much does one banana cost? 600 dong 3, Practice Listen and answer the teacher’s Use the things that are in the class question to ask: How much does ... interesting? Now you will listen to a Listen to the teacher conversation in which they are solving problem You read and answer: How much does one banana cost? 2, Presentation Play the tape Have...
- 4
- 804
- 1
Anh văn lớp 7 - Unit five: Work and play. A/ In class (A5, A6, A7) pdf
... look at Now discuss 3, Practice with a partner, and explain doing it: carefully to teacher’s explaining We have names of subjects in accordance with relevant words about each subject You will find ... essay, past, Find the new words and read them present, around, world Read loudly in front of the class Call some students and have them read the passage Answer the teacher’s question Listen and ... Now we read the passage to know the subjects that the Vietnamese students learn 2, Presention Play the tape and ask the students to Listen to the tape and read read while listening Introduce...
- 4
- 2,724
- 1
Unit 5: A. In class
... Name the subjects Geography Physics Biology • What are you doing? • What is your favorite subject? History Warm –up Chain game: Teacher: Today we have English Student 1: We have English and Math ... Yes:………no:…… Answer questions about Hoa and you How many days a week…… Which school ………… What time………… What is her favorite subject? What does she in … ? Does she any experiments in …….? How many days a ... Eliciting In a week, how many days you go to school? What time classes begin? Do you like English? What is your favorite subject? Open-prediction Mai goes to school on Saturdays Her Classes begin at...
- 10
- 488
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25