a gift from malla
A Call from the Dark
Ngày tải lên :
06/11/2012, 16:13
... have a
6
Robert’s heavy, knee length black coat clung to him tight, like cling film. It was
about two sizes too small. And what was with that coat anyway? It was almost summer
and I was ... nobody called
him that) said nothing to me at all about having a package waiting for this guy.
‘Don’t worry, I can come back,’ he said when he realised I didn’t know what he
was talking about. ... wonder why I don’t have one.
In fact we don’t have any pets at all. They’ve all gone and died, including a couple of
cats, a goldfish and a white rabbit called Snow that Mum and Dad bought me for...
- 11
- 470
- 0
A visit from a pen pal
Ngày tải lên :
17/01/2013, 09:58
... South East Asian Nations: Hiệp hội các nước
Đông Nam Á
Website học trực tuyến – www.videobook.vn
official (adj): chính thức
Ex: There will be an official investigation into last week’s accident. ... www.videobook.vn
Ex: The atmosphere over the party was warm and friendly.
(Không khí b a tiệc rất đầm ấm và thân mật.)
to pray (v): cầu nguyện; cầu khấn
Ex: We all prayed that she would soon recover. ... building has been a place of worship since the eighth century.
(T a nhà này đã trở thành nơi thờ phụng từ thế kỷ thứ tám.)
-> to worship (v): thờ; thờ phụng; tôn thờ
ASEAN (abbr) Association...
- 5
- 1.7K
- 0
Unit 1: A visit from a pen pal
Ngày tải lên :
21/06/2013, 01:27
... students will be able to use past simple, and
past simple with wish
II. Language contents:
1. Grammar :
2. Vocabulary :
III. Techniques : Eliciting questions, asks and answers
IV. Teaching aids : Textbook, ... ask
and answer questions about what Ba,
Nga, Lan, Nam and Hoa did on the
weekend
( exercis1/ P 11)
+Tell them that the activities happened
in definite in the past.
+ Let students practice in ...
conversation between Tan and Phong.
They are talking about Ba did on the
weekend.
+ Give the model
Form :
VERB + ED or PAST FORM OF
IRREGULAR VERB ( V2 )
+Ask students to work in pairs to ask
and...
- 2
- 1.1K
- 0
Unit 1: A visit from a pen pal
Ngày tải lên :
21/06/2013, 01:27
... in it.
The past simple with wish
+ Give example and explain the way to
use
Ex : a. You are a student ( I wish I were
a teacher )
b. You live in a bike. ( I wish I
lived in a car )
Form : ... visited.
* Cues :
- Lang Biang Mountain / blimbing
- Xuan Huong Lake / walk around
- Valley of Love / sightseeing
A : I think I’ll take my friends to
………….We can ……
B : Good ideas ! I believe they ... : I wish + S + Past subjunctive
+ Ask students to look at the real
situations and make wishes
• Sample answers :
a) I wish I were in the swimming
pool now .
b) I wish I had a computer now...
- 3
- 933
- 0
Unit 1_ A visit from a penpal
Ngày tải lên :
26/06/2013, 01:27
...
1. Lan met her Malaysian pen pal, Razali Maryam last week.
Listen and check the places they visited.
Answer these Qs.
Created by TTM_titiempi
Malaysia Viet Nam
Area
Population
Capital city
Climate
Unit ... city
Climate
Unit of currency
Official religion
( &
others
)
National language
Compulsory
second language
Unit 1: a visit from a pen pal
Imagine a foreign
pen pal is coming to stay
with ... word:
1. Japan _________________four main islands Hokkaido, Honshu, Shikoku, and Kyushu
.
2. A Japanese lunch is a light meal and may _________________ of tsukemono, salted fish, and tsukudani, seafood...
- 4
- 552
- 0
unit 1: A visit from a penpal- t3,t4
Ngày tải lên :
16/09/2013, 13:10
... Tim and Carol
are and that they are doing.
- Listening and choosing the correct answers.
- Comparing their answers with the partner’s.
* key:
a- 1 b-2 c-2
where Tim and Carol
are and that they ... questions.
2-Vocabulary: Some words relating to capitals and big cities in the word,
especially in Asia.
II. Preparation:
Pictures, cassette player and tape.
III. Procedures:
1- organization: goodmorning!
Who ... them.
3- Post - reading: Speaking
T gives some questions about Malaysia:
1. Is Malaysia one of the countries of
the ASEAN?
2. How many regions are there?
3. Is Kuala Lumpur the largest city in...
- 6
- 631
- 0
unit1: A visit from a pen pal
Ngày tải lên :
17/09/2013, 03:10
... Viet Nam
2-The capital of Malaysia is JakarTa
3-Education is free in Malaysia.
4-Malaysia has Twins-towers
5-The currency in Malaysia ia VND
III-While-reading
Keys: 1-T 2-F 3-F 4-T 5-F
Task 1: ... the table.
1-area: 329,758 sq km
2-population: 22 triệu ngời
3-climate: tropical
4-Unit of currency: Ringit
5-Capital city: Kuala Lumpur
6-Official religon: Islam
7-National language: Bahasa
8-Compulsory: ... months last year.
3. _______ my way_______school this morning, I saw a car accident
VI. Listen carefully and complete the sentences (1pt)
1. Canada is the second largest country……
2. The Capital...
- 172
- 3.8K
- 4
A VISIT FROM PEN PAL
Ngày tải lên :
19/09/2013, 02:10
... tropical climate
4 . ringgit
5 . Kuala Lumpur
6 . Bahasa Malaysia
7 . English
V . HOMEWORK:
- Write some information to
describe Malaysia in the notebooks
Ex : Malaysia is a member of
ASEAN ... task:
1 .T
2 . F
3 . F
4 . F
5 . F
2.Questions:
1 . How many regions are there in
Malaysia ? What are they ?
2 . What is the population of Malaysia
in 2001 ?
3 . What is the area of Malaysia ... the poster
- Asking Ss to ask and answer
about Ba , Lan , Nam and Hoa
- Taking part in the
activities in groups
( Red and White )
- Listening and
repeating after the
teacher about the
words...
- 14
- 449
- 0
Tài liệu Saving and Loading a DataSet from XML pptx
Ngày tải lên :
24/12/2013, 05:15
... tables. The XML schema and data for the DataSet
is written both to a file and to a text box on the form.
Read Button.Click
Creates a DataSet and reads in schema and data from a file containing ... Team LiB ]
Recipe 8.2 Saving and Loading a DataSet from XML
Problem
You need to save a DataSet as an XML file and create a DataSet from an XML file.
Solution
Use the XmlTextWriter and ... DataTable orderTable = new DataTable(ORDERS_TABLE);
da.FillSchema(orderTable, SchemaType.Source);
da.Fill(orderTable);
ds.Tables.Add(orderTable);
// Fill the OrderDetails table and add...
- 11
- 429
- 1
Tài liệu Relationship between anthropometric variables and nutrient intake in apparently healthy male elderly individuals: A study from Pakistan docx
Ngày tải lên :
14/02/2014, 06:20
... RESEARCH Open Access
Relationship between anthropometric variables
and nutrient intake in apparently healthy male
elderly individuals: A study from Pakistan
Iftikhar Alam
1,2*
, Anis Larbi
3
, ... Khyber
Pakhtunkhwa (Previously: NWFP), 25000, Pakistan.
Authors’ contributions
IA and GP designed research; IA, and PIP conducted research and collected
the data; IA and AL analyzed the data; IA wrote the manuscript; ... 16:289-98.
doi:10.1186/1475-2891-10-111
Cite this article as: Alam et al.: Relationship between anthropometric
variables and nutrient intake in apparently healthy male elderly
individuals: A study from Pakistan. Nutrition Journal 2011...
- 9
- 525
- 0
Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx
Ngày tải lên :
14/02/2014, 21:20
... Mouelle-Sone A, Moscol A, Zaharia M, Zaman S, Perez
Escutia MA. Fractionated half3 body irradiation (HBI) for the rapid palliation of widespread, symptomatic
metastatic bone disease: a randomised phase ... and chemotherapy can have a major palliative role.
4.1.4 Hormone therapy
Breast and prostrate cancer account for a large number of patients who present with metastatic
disease and cancer pain ... headache may also be due to anxiety and depression and that other
common, non-malignant causes of headache may be found in patients with advanced
cancer, such as tension headache and migraine....
- 116
- 548
- 0
Tài liệu Báo cáo khoa học: Aldehydes release zinc from proteins. A pathway from oxidative stress⁄lipid peroxidation to cellular functions of zinc pptx
Ngày tải lên :
19/02/2014, 06:20
... effects of etha-
nol and treatment with disulfiram. Alcohol Alcohol 28,
461–468.
30 Isse T, Oyama T, Kitagawa K, Matsuno K, Matsumoto
A, Yoshida A, Nakayama K, Nakayama K & Kawa-
moto T (2002) ... Gasso M, Rubio M,
Caballeria J, Pares A, Rodes J & Fernandez-Checa JC
(2000) Enhanced DNA binding and activation of tran-
scription factors NF-kappa B and AP-1 by acetaldehyde
in HEPG2 cells. ... chem-
istry-generated free radicals [27]. In diabetes, there are
pathways for the increased formation of a- keto-
aldehydes such as glyoxal and methylglyoxal from
glyceraldehyde 3-phosphate. Autoxidation of a- hydroxy-
aldehydes...
- 11
- 473
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
Ngày tải lên :
19/02/2014, 19:20
... senses across
dictionaries, hence Wik is only used as augmented
data for WMF to better learn the semantics of words.
All data is tokenized, POS tagged (Toutanova et al.,
2003) and lemmatized, ... our disambiguation algorithm. It is a graph-
based algorithm, where nodes are senses, and edge
weight equals to the sense pair similarity. The final
answer is chosen as the sense with maximum ... (adjectives and adverbs) do not have
a taxonomic representation structure. For example,
the jcn similarity measure (Jiang and Conrath, 1997)
computes the sense pair similarity score based on the
information...
- 5
- 585
- 0
Tài liệu Báo cáo khoa học: Purification and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt
Ngày tải lên :
20/02/2014, 23:20
... CTGATCTAGAGGTACCGGATCC
5RACF ATCCTCACGAACAAGCAG
5RACR GATCGCGATGCAGGCCTT
FLF1 GGACGACTACAGCGTCTTCAGTAGA
FLR1 TCCAAACAGTCAGTTTCTTAACCGT
Table 1. Purification of cellulase from abalone Haliotis discus hannai. ... The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A
putative signal peptide is indicated by a dotted underline. The amino-acid sequences ... (OH,
USA), TOYOPEARL CM-650
M
was fromToyo Soda Mfg,
Co. (Tokyo, Japan), Sephacryl S-200 HR was from Amer-
sham Pharmacia Biotech AAB (NJ, USA), and Hydroxy-
apatite (Fast Flow Type) was from Wako...
- 8
- 511
- 0
