... Preface For reasons of temperament and training, I find it natural and exciting to make forays across what many scholars see as an unbridgeable divide between the humanities andthe natural sciences ... things as religious, mystical, magical, and so forth within larger processes of meaning making and valuation (singularization), we are better able to analyze the contestations over the meaning and ... “religious” and then some We can consider specialness both behaviorally and substantively, asking if there are behaviors that tend to mark things off as special and if there are particular types of things...
... data analysis and performed the statistical analysis PRvW participated in the design and coordination ofthestudyand helped to draft the manuscript All authors read and approved the final manuscript ... (16,16dimethyl-PGF 2a) was prepared in ethanol (2 ng/μL) and was added to all composite standards at a final concentration of 100 pg/μL Chromatograms for standards were used to establish characteristic ... (16,16-dimethyl-PGF a) were calculated and plotted against the concentration ofthe calibration standards Calibration lines were calculated by the least squares linear regression method Sample collection and storage...
... CU914524.3 andthe potato BAC AC233501.1 Representation ofthe co-linearity between the tomato BAC CU914524.3 andthe potato BAC AC233501.1 The BAC CU914524.3 from tomato andthe BAC AC233501.1 ... mapped onto the BAC CU914524.3 from tomato andthe BAC AC233501.1 from potato The two BACs are present schematically at the center ofthe figure and were selected because they share a remarkable ... EST/TC alignments along the tomato andthe potato genomes The mapping of Solanaceae ESTs certainly provides insights into the location of potential candidate genes and facilitates EST-driven gene annotation...
... that it will walk away.’ Sem: ‘Kla goes out to seek Laay in the cane field and he finds that it is about to walk away.’ The sentence in (17) are split into two SVCs: the series of V1 to V3 andthe ... variable quantification to resolve pro-forms and VP ellipses to their antecedents The variable quantification in TLG is comparable tothe use of memory in storing antecedents and anaphora The verbs ... in analytic languages by incorporating CCG with a memory mechanism In the memory mechanism, fillers and gaps are stored as modalities that modalize a syntactic category The fillers andthe gaps are...
... into a formal, and in particular, a computational analysis of d i s c o u ~ ? The natural alternative toa syntactic definition is a semantic one andtheapproachto se,manties which offers the ... is the guy at the door andthe speaker andthe relationship ofthe speaker having told the guy at the door to watch out The word but can be viewed as function mapping situation-types into situatiun-types ... st - and can be regarded as representing the Iocutionary aspect ofthe act The other gives the set of situation-types ofthe diseoursc situation (including author and reader or speaker and addressee)...
... Hague for other systems to which we can compare them We take this level of success as an indication ofthe feasibility of our data-driven, modular approach Additionally, our approach has the advantage ... Data The data on which the classifiers are trained and tested is an extract of 7915 sentences from the Penn Treebank (Marcus et al., 1993), which are tagged to indicate the location of WH gaps ... the VP node Finally, within the VP subtree it should predict the location ofthe gap as the last child ofthe parent VP SBARQ - begin at the first branching node dominating the WH operator, and...
... doi:10.1016/j.na.2005.06.028 Bae, J-H, Park, W-G: On a cubic equation anda Jensen-quadratic equation Abstr Appl Anal 2007 (2007) Article ID 45179 Găvruta, P: A generalization ofthe Hyers-Ulam-Rassias stability of approximately ... for all x, y Î X and all n Î N, that is, d(T n f , T n+1 f ) ≤ same reasoning ofthe proof of Theorem 2.3, we have Ln+2 16 < ∞ for all n Î N By the Bae and Park Journal of Inequalities and Applications ... : = ax2 + bxy + cy2 is a solution ofthe Equation 1.1 The authors [12] acquired the general solution and proved the stability ofthe functional Equation 1.1 for the case that X and Y are real...
... Rassias, “On the stability of functional equations anda problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 12 S.-M Jung and P K Sahoo, “Stability ofa functional equation ... transformations,” Bulletin ofthe American Mathematical Society, vol 57, pp 223–237, 1951 Th M Rassias, “On the stability ofthe linear mapping in Banach spaces,” Proceedings ofthe American Mathematical ... “On the stability ofthe linear transformation in Banach spaces,” Journal ofthe Mathematical Society of Japan, vol 2, pp 64–66, 1950 D G Bourgin, “Classes of transformations and bordering transformations,”...
... paper, we will adopt the idea of C˘ dariu and Radu [12] and prove the Hyersa Ulam-Rassias stability andthe Hyers-Ulam stability ofthe Volterra integral equation (1.2) Hyers-Ulam-Rassias stability ... Rassias, “On the stability of functional equations anda problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 [11] J B Diaz and B Margolis, A fixed point theorem ofthe ... 143–190, 1995 [5] P G˘ vruta, A generalization ofthe Hyers-Ulam-Rassias stability of approximately additive a ¸ mappings,” Journal of Mathematical Analysis and Applications, vol 184, no 3, pp...
... out to be a natural alternative tothe MAP approach proposed by Foulley and Gianola !8! The main advantage ofthe MAP approach lies in both its conceptual and computational simplicity Part of ... effects is the quasi-score approachof Me Cullagh and Nelder [30] which only requires the mean and variance ofthe data distribution In particular, an appealing version ofthe quasi-score approach for ... J.L., San Cristobal M., Gianola D., Im S., Marginal likelihood and Bayesian approaches tothe analysis of heterogeneous residual variances in mixed linear Gaussian models, Comput Stat Data Anal 13...
... separated the patient and professional groups in order to facilitate frank discussion, and broad and rapid brainstorming To maximize the richness and depth ofthe data obtained, we used a nominal ... interpretations and applications that are validated To maximize the likelihood of producing valid data in relation toa range of possible interpretations and applications ofa tool, there are development ... interpretation of data at the group level to interpretation at the individual level usually requires additional technical analysis as well as a body of evidence about the meaning and behavior of each...
... birth dates, the revenue ofafamilyandthe number of cars they own, andthe profits generated by a bank in France and in Singapore A full studyofthe theory of correlation is not the subject of ... price ofthe nth -to- default standard Basket CDS as a function of n, the number of defaults before the payment is made 77 Evolution ofthe price ofthe 1st -to- default standard Basket CDS as a function ... empirical data the i-th order statistic is the i-th smallest value ofa statistical sample 42 2.3.1 Concordance Informally, the concordance ofa pair of random variables measures if ‘large’ values of...
... Journal of Mathematical Analysis and Applications, vol 184, no 3, pp 431–436, 1994 L C˘adariu and V Radu, “On the stability ofthe Cauchy functional equation: a fixed point approach, ” in Iteration ... Academy of Sciences ofthe United States of America, vol 27, pp 222–224, 1941 T Aoki, “On the stability ofthe linear transformation in Banach spaces,” Journal ofthe Mathematical Society of Japan, ... Aequationes Mathematicae, vol 44, no 2-3, pp 125–153, 1992 13 G Isac and Th M Rassias, “Stability of Ψ-additive mappings: applications to nonlinear analysis,” International Journal of Mathematics...
... treated the Cy3 and adjusted Cy5 intensities as technical replicates and calculated the mean of these values The ratio of this mean on the average ofthe intensity across the array set was then ... array, the geometric mean ofthe measured fluorescence intensities was calculated for both the experimental and control andthe ratio of these was used as a scaling factor to adjust the values of all ... contributions EG analyzed all the microarray data and printed the arrays NM printed the arrays and participated in some ofthe expression studies AP performed many ofthe expression studies andthe ChIP-chip...
... customer satisfaction through perceived service quality” Parasuraman, A (1985) A conceptual model of service quality and its implications for future research” Parasuraman, A (1988) “SERVQUAL: A ... to improve it or what they dislike about the services and how to fix the flaws Free Powerpoint Templates Page There are many gaps between customer and service provider Understand these gaps ... have to spend another year to improve their examination score hoping to get in the year after Some apply tothe other 400 private universities and colleges Free Powerpoint Templates Page To...
... tothe design ofthe study, in the analysis and interpretation of data, and drafting ofthe manuscript AD was responsible for the Danish arm of EXACTLE and reviewing/contributing to writing the ... 27709, USA) and was conducted between November 2003 and January 2007 Two ofthe authors ofthe manuscript (MW and CD) are employees of Talecris and participated in the design ofthe study, in the ... thestudy therapy and had at least valid CT scan measurement at baseline and valid CT scan assessment at Month 12 or thereafter [13] Page of 10 (page number not for citation purposes) Respiratory...
... Heyer AG (2010) Mathematical modelling ofthe central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase on whole plant carbon metabolism ... 6-phosphate; 30% KOH was added tothe control of each assay Reactions were incubated for 30 at 25 and °C, and then at 10 at 95 °C Anthrone 0.2% in 95% H2SO4 was added, andthe samples were incubated ... Experimental procedures, the rate of assimilate export from photosynthetically active source organs to consuming sink organs or metabolic pathways other than carbohydrate pathways was calculated as the...
... methionine and variable deamidation of asparagine and glutamine Parent and fragment mass tolerances were set to Da Up to two missed cleavages and half tryptic peptides were allowed The taxonomic search ... BLASTP-based protein database searching and functional classification All peptide sequence tags (Table 2) were searched against the dog genome database using BLASTP, version 2.2.16 Database size was ... match-set Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total Activated meprin Non-activated meprin In total Activated...
... ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG ... CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R OMCB-PBAD-F OMCB-PBAD-R 3736 controlled by an arabinose promoter [26], was achieved as visualized by heme staining of SDS ⁄ PAGE ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards...
... brought and placed around the feet and legs ofthe horse, and gradually laid up to its sides, and at last over the back and head ofthe unsuspecting animal, and last of all over the head and even the ... layer of Dall] There are some crania found by us in the lowermost part ofthe Amaknak cave anda cranium obtained at Adakh, near the anchorage in the Bay of Islands These were deposited in a ... erected, to which the skulls and hair are attached as a trophy The bow, arrows, assagai, and clubs ofthe deceased are on the same post Large stones are pressed into the soil above and around the grave,...