a first assessment of their functional roles
Báo cáo y học: "Plastic architecture of bacterial genome revealed by comparative genomics of Photorhabdus variants" ppsx
Ngày tải lên :
14/08/2014, 20:22
... analysis SG analyzed sequence data SG wrote the paper with contributions from AG and EJ-B Additional data files The following additional data files are available with this paper Additional data ... colonial variant Bacteria obtained at the end of the exponential phase were injected into fourth-instar larvae Mortality values are based on data obtained after injection into 20 larvae All experiments ... phase variation Phase variation is an adaptive process by which certain bacteria within a bacterial subpopulation, called phase variants, undergo frequent and reversible phenotypic changes Phase...
- 15
- 232
- 0
Tiểu luận tiếng anh : Robinson Crusoe – A Representative of the English Bourgeoisie in the early 18th century
Ngày tải lên :
26/11/2012, 12:02
... for sheep-raising and wood-making industries They had to join the force of cheap labor and working in such factories England became a typical example of initial accumulation of capitalism Holding ... goat and say: “this is a goat” and then signal to Friday to say what it was called in his language Crusoe pointed to a goat and said ‘This is a goat”-end of discussion He even clothed Friday in ... him from cannibalism to a real Christian man who believed in God Master servant relationship in “ Robinson Crusoe” can also be seen as a relation of capitalism as they devided labour among them...
- 15
- 2.3K
- 9
báo cáo hóa học:" Phase I/II open-label study of the biologic effects of the interleukin-2 immunocytokine EMD 273063 (hu14.18-IL2) in patients with metastatic malignant melanoma" docx
Ngày tải lên :
18/06/2014, 15:20
... Ohta S, Shitara K, Hanai N: Immunocytochemical study on internalization of anti-carbohydrate monoclonal antibodies Anticancer Res 1993, 13:2207-2212 Wargalla UC, Reisfeld RA: Rate of internalization ... Boards for Novartis, Antigenics, Schering and Medarex AK and OK are employees of Merck KGaA; OK is also an Adjunct Professor at the University of North Carolina at Chapel Hill, NC, USA SDG is a ... inpatient interleukin-2 regimen: a randomized phase I trial in patients with metastatic melanoma and renal cell carcinoma J Immunother 2003, 26:130-138 Antony PA, Paulos CM, Ahmadzadeh M, Akpinarli...
- 11
- 673
- 0
Lời bài hát Rhythm Of The Rain
Ngày tải lên :
03/12/2015, 13:07
... to the rhythm of the falling rain Telling me just what a fool I've been I wish that it would go and let me cry in vain And let me be alone again Hãy lắng nghe nhịp điệu tiếng m a rơi Nó bảo tôi ... thêm lần Oh, listen to the falling rain Pitter pater, pitter pater Oh, oh, oh, listen to the falling rain Pitter pater, pitter pater Ô, lắng nghe nhịp điệu tiếng m a rơi Tí tách, tí tách Ô, ô, ... pater Ô, lắng nghe nhịp điệu tiếng m a rơi Tí tách, tí tách Ô, ô, ô, lắng nghe nhịp điệu tiếng m a rơi Tí tách, tí tách ...
- 2
- 280
- 0
Báo cáo y học: "Multivariate explanatory model for sporadic carcinoma of the colon in Dukes’ stages I and IIa"
Ngày tải lên :
03/11/2012, 11:34
... [20] Sample size was taken into account [21] A first analysis was made on the “raw” data package The selection of variables was always backward In the variables in which lost information surpassed ... for its later statistical analysis, and the quality controls were also made at this stage Statistical analysis An initial study was made on the set of records to obtain centralization and dispersion ... moment of the construction of the data package The fundamental cause was the lack of fulfilment of the inclusion criteria The assembly of the previous data package with a total of 93 records (53 cases...
- 8
- 559
- 0
Tài liệu I MMIGRANT S MALL B USINESS OWNERS: A S IGNIFICANT AND G ROWING PART OF THE E CONOMY pdf
Ngày tải lên :
18/02/2014, 00:20
... Israel/Palestine Syria Iran Lebanon Jordan Italy Korea South Africa Ireland Iraq Pakistan Turkey Argentina Egypt/United Arab Rep Taiwan England Cuba Venezuela Canada United Kingdom, ns Romania ... Poland India France Germany Portugal Brazil Hong Kong Ukraine Other USSR/Russia Japan China Vietnam Nigeria Colombia Thailand Nicaragua Peru Ecuador Trinidad and Tobago Guyana/British Guiana Jamaica ... Mexico India Korea Cuba China Vietnam Canada Iran Philippines Poland Italy Colombia Taiwan Germany El Salvador Pakistan England Greece Brazil Israel/Palestine Dominican Republic Jamaica Other USSR/Russia...
- 37
- 436
- 0
Tài liệu Báo cáo khoa học: Post-translational modifications of the linker histone variants and their association with cell mechanisms docx
Ngày tải lên :
18/02/2014, 08:20
... data for chicken were taken from [44] Chicken H101 H110 H102 H103 H11L H11R H5 a- S a- S a- S a- A a- S a- A a- pT T T T pT T pT pS A A A A A A A A A A A P – pS P P P P A A – P A S A A A P A A A A A ... a- T a- pS a- pS a- S a- pS a- pS N pT A T pT pT pS A A A A A A A A A A E aK S A P P P – aK aK 2mK K K – P A pT pT pS – aK K K K K – mK K K K K K A mK T K K K K R R R mR S K a ⁄ mK a ⁄ mK mK mK D A ... a- S a- pS N T T T T T S V A A A A A A A A A E – S A P P P – K aK aK aK aK – P A pT pT pS – aK K K K K – K K K K K K P A K A K K K R R R R S K aK aK aK K D A pS pS pS T S S S S S S A Q auK auK auK...
- 13
- 633
- 0
Tài liệu Báo cáo khoa học: The localization of FGFR3 mutations causing thanatophoric dysplasia type I differentially affects phosphorylation, processing and ubiquitylation of the receptor pptx
Ngày tải lên :
19/02/2014, 00:20
... Stewart AK (2004) Preclinical studies of fibroblast growth factor receptor as a therapeutic target in multiple myeloma Br J Haematol 124, 595–603 38 Maeda T, Yagasaki F, Ishikawa M, Takahashi N ... stable transfection of cDNA constructs versus transient transfection of plasmids Polyubiquitylation is responsible for the internalization and proteasomal degradation of several plasma membrane ... GA, Webster MK, Bamshad MJ, Fraley AE, McIntosh I, Szabo J, Jiang W, Jabs EW, Wilcox WR et al (1999) A novel skeletal dysplasia with developmental delay and acanthosis nigricans is caused by a...
- 16
- 573
- 0
Tài liệu Báo cáo khoa học: Quantitative analysis of the experimental O–J–I–P chlorophyll fluorescence induction kinetics Apparent activation energy and origin of each kinetic step Steve Boisvert, David Joly and Robert Carpentier doc
Ngày tải lên :
19/02/2014, 05:20
... observation is easily explained by the fact that a nonsaturating concentration of DCMU was used, meaning that only a fraction of the PSII reaction center was affected by DCMU Then, the intact fraction ... untreated thylakoids incubated at the maximal and minimal temperaTable Quantitative analysis of uorescence induction (FI) in spinach thylakoids at 21 C FI traces were tted with three exponential ... particular, the characteristics of the JI phase are almost impossible to determine from visual analysis of the traces It was shown that the three phases can be quantitatively resolved using a sum of...
- 8
- 711
- 0
Tài liệu Báo cáo khoa học: Unusual metal specificity and structure of the group I ribozyme fromChlamydomonas reinhardtii23S rRNA pptx
Ngày tải lên :
19/02/2014, 07:20
... exon, and 25 bp of the 3Â exon Oligo 104 (45 nucleotides, TAATACGACTC ACTATAGGGATCGAATTCTGGGTTCAAAACGTAA) contains, in order, a T7 RNA polymerase promoter (nucleotides 117), a six-nucleotide transcription ... cleavage of 23S.5DGb pre-RNA, and quantication %Preịt ẳ A expka tị ỵ B expkb tị A and ka are the percentage and observed rate constant for the fast-reacting pre-RNA, and B and kb are the same ... RNA cleaved with Mn2+ at GAAA sequences (nucleotides 56, 257 and 323); A, G, A U, and C, enzymatic sequence ladder of S RNA; OH, partial alkaline hydrolysis of S RNA; and M, 5Â end-labeled DNA...
- 14
- 480
- 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx
Ngày tải lên :
19/02/2014, 16:20
... follows: anti-porin from Calbiochem, anti-HA from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively Antibodies against ... membranes Anti-HA and anti-porin sera were used at : 5000 dilution whereas the anti-MWFE and anti-18 kDa sera were used at : 1000 dilution Horseradish peroxidase-conjugated secondary antibodies (anti-rabbit ... assembly of an active mammalian mitochondrial complex I Experimental procedures Cell lines and cell culture The isolation and preliminary biochemical and genetic characterization of a series of respiration-deficient...
- 9
- 622
- 0
Tài liệu Báo cáo khoa học: Phylogenetic relationships in class I of the superfamily of bacterial, fungal, and plant peroxidases pptx
Ngày tải lên :
19/02/2014, 16:20
... Catalase–peroxidase Ascorbate peroxidase (thylakoid) Ascorbate peroxidase Catalase–peroxidase Catalase–peroxidase Catalase–peroxidase Catalase–peroxidase Catalase–peroxidase Catalase–peroxidase ... Catalase–peroxidase Catalase HPI Catalase–peroxidase Ascorbate-dependent peroxidase Catalase–peroxidase Ascorbate peroxidase Catalase–peroxidase Catalase–peroxidase Catalase–peroxidase Ascorbate ... Catalase–peroxidase Catalase–peroxidase Catalase I Catalase–peroxidase Catalase–peroxidase Catalase–peroxidase Cytochrome c peroxidase Ascorbate peroxidase Peroxidase/catalase Ascorbate peroxidase Ascorbate peroxidase...
- 13
- 512
- 0
Tài liệu Báo cáo khoa học: Effect of deletion of the DNase I hypersensitive sites on the transcription of chicken Ig-b gene and on the maintenance of active chromatin state in the Ig-b locus docx
Ngày tải lên :
19/02/2014, 16:20
... but also are likely to participate in the establishment and maintenance of an active chromatin state [18,28,29] In addition to their presence in and adjacent to active or potentially active genes, ... 9210 and image quant (Amersham Biosciences, Piscataway, NJ, USA) Acetylation status of H3 and H4 histones was examined by chromatin immunoprecipitation (ChIP) and real-time PCR (R-PCR) as described ... recombinant clones by PCR and tamoxifen treatment To determine homologous recombination, PCR was carried out as described [45] using the following primers: 5¢CGATTGAAGAACTCATTCCACTCAAATATACCC-3¢ (in Bsr...
- 11
- 638
- 0
Tài liệu Báo cáo khoa học: Characterization of ICAM-4 binding to the I domains of the CD11a/CD18 and CD11b/CD18 leukocyte integrins pptx
Ngày tải lên :
20/02/2014, 11:20
... I domain of CD1 1a, and partially but significantly inhibited the interaction between ICAM-4 L cells and CD1 1a I domain The adhesion of all ICAM transfectants to the I domain of CD1 1a was almost ... control was purchased from Silenius (Hawthorn, Australia) and polyclonal goat anti-GST antibodies from Pharmacia Biotech Inc The goat antihuman IgG specific antibody was obtained from Sigma and the ... Inhibition of adhesion of ICAM transfectants to purified CD11b I domain GST fusion protein The effects of anti-ICAM and anti-I domain mAbs on adhesion of ICAM transfectants to 0.4 lg of I domain GST captured...
- 14
- 495
- 0
Tài liệu Báo cáo Y học: Role of electrostatics in the interaction between plastocyanin and photosystem I of the cyanobacterium Phormidium laminosum ppt
Ngày tải lên :
21/02/2014, 01:21
... cyanobacteria and algae: an instance of unusual genetic-variability Biochim Biophys Acta 766, 310–316 ´ Balme, A. , Hervas, M., Campos, L .A. , Sancho, J., De la Rosa, M .A & Navarro, J .A (2002) A ... interaction of plastocyanin with photosystem I in Anabaena [15], and is highly conserved in cyanobacterial plastocyanins Mutagenesis, expression, purification and characterization of the plastocyanins ... 14 Hervas, M., Navarro, J .A. , Dı´ az, A & De la Rosa, M .A (1996) A comparative thermodynamic analysis by laser-flash absorption spectroscopy of photosystem I reduction by plastocyanin and cytochrome...
- 10
- 673
- 0
Báo cáo khoa học: Comparing the substrate specificities of cytochrome c biogenesis Systems I and II docx
Ngày tải lên :
06/03/2014, 09:22
... C3 5A, C35AF and C35AR; c550 C3 8A, C38AF and C38AR; c550 C35AC3 8A, C35AC38AF and C35AC38AR H thermophilus cytochrome c552 and its AXXCH, AXXAH and CXXAH variants were expressed from the plasmids ... of its signal peptide is approximately kDa, whereas the uncleaved product has a mass of approximately 11 kDa Maturation of single-cysteine holocytochromes There are natural examples of cytochromes ... in nature in the mitochondria of Euglenozoan organisms, such as Crithidia fasciculata, and it has been demonstrated that the overall structure of cytochrome c from this organism bears remarkable...
- 12
- 469
- 0
Báo cáo khoa học: Insertion of the plant photosystem I subunit G into the thylakoid membrane In vitro and in vivo studies of wild-type and tagged versions of the protein doc
Ngày tải lên :
07/03/2014, 21:20
... CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCG AAAAAGAAGCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined) and 5¢-GCGGCATGCTCATCCAAAGAAGC TTGGGTCG-3¢ The two amplified fragments ... TGGAAATGGGTTTTTCCGTTCTGC-3¢ (His-tag underlined) or 5¢-TGGAGCCACCCGCAGTTCGAAAAAGAA GCTGGAGATGATCGTGCT-3¢ (Strep-tag underlined), then a secondary amplification with primers 5¢-CACCAC CACCACCACCACGAAGCTGGAGATGATCGTGCT-3¢ ... PSAG with a C-terminal Strep-tag (PSI-G-StrepTerm), 5¢-GCGGAGCTCAT GGCCACAAGCGCATCAGC-3¢ and 5¢-GCGGCATGCT CATTTTTCGAACTGCGGGTGGCTCCATCCAAAGAA GCTTGGGTCGTAT-3¢ (region encoding the Strep-tag,...
- 9
- 422
- 0
Báo cáo Y học: Characteristics of binding of insulin-like growth factor (IGF)-I and IGF-II analogues to the type 1 IGF receptor determined by BIAcore analysis pptx
Ngày tải lên :
08/03/2014, 22:20
... calculation of kd/ka, where ka is the association rate and kd is the dissociation rate Relative Kd is equal to Kd of IGF-I/Kd of IGF analogue Dashes indicate data inappropriate for assessing association ... deprivationinduced PC12 cell death and DNA fragmentation Survival assays (MTT-based assay) and DNA fragmentation ELISAs were performed as described in Materials and methods, and the data are presented ... mutant IGF analogue to rhIGF1R Data were analysed using BIAevaluation software 3.0 and ®tted to a Langmuir : binding model as outlined in Materials and methods The dissociation constant (Kd) was determined...
- 8
- 482
- 0
Báo cáo Y học: Properties of group I allergens from grass pollen and their relation to cathepsin B, a member of the C1 family of cysteine proteinases pdf
Ngày tải lên :
08/03/2014, 22:20
... recombinant allergen after affinity purification using the mAb IG12 [18] The natural allergen Phl p was also found to be capable of degrading a synthetic substrate at a papaincleavage site after incubation ... enables expansin activation, accumulation and catalysis under identical pH conditions and explains how expansins may mediate acid growth of plant cell walls Theoretical pI calculations show that ... strong degradation of the full-length allergen and accumulation of a truncated 15-kDa fragment at about pH 4.5 (Fig 3A) This sharp band lacked the N-terminal peptide, as the N-glycosylated Asn residue...
- 10
- 535
- 0