a firm must take reasonable care to organise and control its affairs responsibly and effectively with adequate risk management systems
more straw bale building a complete guide to designing and building with straw - chris magwood
... move, load, and stack, and they make a big mess Settle in advance all issues of labor and cleanup If you have a crew on hand to load and unload a truck, it will save time and may be necessary before ... potential toxicity of a home Although the benefits of using straw bales are many, straw is not actually a magical material This cheap and abundant cellulose fiber just happens to get packaged into ... compromise with bale walls Attaching a vapor barrier to a straw wall offers many complications The barrier can only be attached to the top and bottom of the wall, Inspection of mold in straw bale walls...
- 297
- 505
- 0
Báo cáo y học: "Study of the outcome of suicide attempts: characteristics of hospitalization in a psychiatric ward group, critical care center group, and nonhospitalized group" pdf
... crisis and case management Clinical manual for assessment and treatment of suicidal patients American psychiatric Publishing, Inc., Washington, DC/ London/England 2005 Baca-Garc a E, Diaz-Sastre ... classification of mental and behavioural disorders: clinical descriptions and diagnostic guidelines World health organization Geneva 1992 Kitamura T, Machizawa S, Maruyama S, Nakagawa Y, Morita ... essential for emergency medical care, community medical care, and community psychic health care services to work hand-in-hand Conclusions We aimed to identify the characteristics and potential needs...
- 8
- 265
- 0
Báo cáo y học: "Universal access: the benefits and challenges in bringing integrated HIV care to isolated and conflict affected populations in the Republic of Congo" potx
... greater medical priorities; malaria, diarrhea, respiratory illnesses, malnutrition and maternal and infant health Staff were also unfamiliar and uncomfortable with HIV management and there was a ... activities including direct clinical care Initially the health staff (expatriate and national) had no significant HIV care experience, and felt reluctant and fearful to begin Thus to help plan ... NACP Catalyst for engagement The introduction of HIV care, initially by an international NGO, acted as a catalyst for the MoH and other actors to engage and commit to HIV in the region In a national...
- 7
- 379
- 0
A study on congruence between ESP course objectives and students’ needs at business management department, vietnam forestry university
... students to be able to scan any of their text materials to get a general idea of its contents, as well as to be able to understand important information in a specific part of a whole text in detail ... they can and should range in level of generality according to what is being taught and who is teaching it Without goals and objectives, a program may have no clear purpose and direction With goals ... develop examinations which are relevant, fair and useful e they help the student to evaluate his/her performance and allocate his/her time more appropriately f finally, and just as important as any...
- 43
- 592
- 0
Social Perspectives in Mental Health Developing Social Models to Understand and Work with Mental Distress potx
... that may be seen to construct the social (as distinct to any physical) aspect of a traumatic experience, and may come to have a profound impact on a person’s sense of self and attachments with ... ‘Mental Health and Inequality’ In T Heller, J Reynolds, R Gomm, R Muston and S Pattison (eds) Mental Health Matters Basingstoke: Macmillan Harding, C., Brooks, G., Takamaru, A. , Strauss, J and ... care programme approach’ State interest in user involvement led to a massive expansion in market research and consultation initiatives in mental health as in other areas of health and social care...
- 242
- 523
- 0
báo cáo hóa học: " Psychometric properties of the Child Health Assessment Questionnaire (CHAQ) applied to children and adolescents with cerebral palsy" ppt
... ADL and has already been applied to patients with other disabling conditions It was translated, culturally adapted and validated for the Portuguese language to be used in Brazilian children and ... the clinical manifestation the patients were distributed into: spastic, extrapyramidal and ataxic The spastic type was classified as hemiplegia, diplegia and quadriplegia according to motor involvement ... diparetic and hemiparetic groups (25.7% and 20.8%, Table 1: Demographic and clinical characteristics of the participants Characteristics Mean age (SD) Male (%) Ethnicity (%) - Caucasian - African-Brazilian...
- 10
- 502
- 0
Báo cáo hóa học: "Research Article A Geometrical-Based Model for Cochannel Interference Analysis and Capacity Estimation of CDMA Cellular Systems" pot
... from the hexagonal model and the inradius circular approach were similar The dependence of the capacity of a WCDMA network on cells sectorization and BS antenna radiation pattern has also been ... Mediterranean Microwave Symposium, pp 1–5, Budapest, Hungary, July 2007 [20] I A Aldmour, K Al-Begain, and A I Zreikat, “Uplink capacity/coverage analysis of WCDMA with switched beam smart antennae,” ... Concise Encyclopedia of Mathematics, Chapman & Hall/CRC, Boca Raton, Fla, USA, 2nd edition, 2002 [17] L E Br˚ ten, M Pettersen, and A Spilling, “An evaluation a of adaptive arrays for a UMTS FDD network...
- 7
- 298
- 0
Báo cáo hóa học: " A Real-Time Model-Based Human Motion Tracking and Analysis for Human Computer Interface Systems" docx
... joint has DOFs, and it can bend on certain 2D planes In a facade view, we assume that the rotation angles of shoulder joint around X-axis of the navel coordinate RUA LUA (θXN and θXN ) are fixed and ... Computational Imaging and Vision, chapter 8, pp 171–198, Kluwer Academic Publishers, Boston, Mass, USA, 1997 [11] C R Wren, A Azarbayejani, T Darrell, and A Pentland, “Pfinder: real-time tracking ... integrator, and one animator Each viewer estimates the partial BDPs from the extracted foreground image and sends the results to the BDP integrator The BDP integrator creates a universal 3D model...
- 15
- 350
- 0
Báo cáo y học: " Repetition and severity of suicide attempts across the life cycle: a comparison by age group between suicide victims and controls with severe depression" ppsx
... American Psychiatric Association: Diagnostic and Statistical Manual of Mental Disorders Fourth edition Washington, DC, USA" American Psychiatric Association; 1994 Motto JA: Suicide attempts A ... by Marzuk et al [50] and been associated with actual suicide attempts [51] Severe suicide attempts are similar to serious attempts as defined by Motto [40] as well as Beautrais [52] that is a need ... Strengths and limitations The present study was based on a sample of 1,206 patients with severe depression/melancholia, who had been rated on a multiaxial schedule and monitored for 37 to 50 years after...
- 7
- 310
- 0
báo cáo khoa học: " PR genes of apple: identification and expression in response to elicitors and inoculation with Erwinia amylovora" doc
... cttcacagtcaccatcttcaaca ggtgcaccagctttttcaa ggcaggcgcagttccaccag gacatgtctccggcgtatca caaaaacggcaatgaaggaacc ctggcgagctcatcatagaactgc agaccaccaagtactactgcac ccaccaatcttgtacacatcc PR-1b PR-1c PR-2 ... name Primer Sequence (5' → 3') PR- 1a gctcagccgtaatacaatcctctc tacccccactactgcacctcact gtttgctgcgcccattag ttgcactttgaaacaccacatc agcttattttgggcatcttcacc gtagttttgccccatatcacacca cttcacagtcaccatcttcaaca ... as a convenient marker of SAR [5] There is a plethora of information about SAR and PR genes related to several model plants, especially, Arabidopsis thaliana [2], and members of the Solanaceae...
- 12
- 320
- 0
Cash Flow Management: A Framework Of Daily Family Activities Glenn Muske1 and Mary Winter Cash Flow Management: A Framework Of Daily Family
... Values as motivators are consistent with Deacon and Firebaugh’s (1988) conceptualization of the management process Family values motivated a man to take an $8000 per year pay cut for the sake of family ... Qualitative Methods This study used a qualitative method to develop a cash management framework Fayol (1929) suggested that to study what a manager does one must ask the manager as well as watch ... themes are found in the data (Muske, 1996) Process Each family manager has a process or a regular method to handle cash flow management The ©1999, Association for Financial Counseling and Planning...
- 12
- 401
- 0
How to Organise a Walking Event docx
... may need to be managed by stewards - with participants gathering in a small ‘muster’ area This control measure allows you to manage the number of participants starting at any one time and to allow ... funds Many local authorities can give advice on sources of local and national grants available to community groups within their area It may also be appropriate to approach local commercial sponsors ... going to put it 6.7 Health and Safety Risk Assessment Any event organised for the public must have an up -to- date risk assessment to demonstrate that the organisers have acted responsibly and done...
- 23
- 339
- 0
báo cáo sinh học:" A model linking clinical workforce skill mix planning to health and health care dynamics" pot
... three years' training ▪ Personnel with minimal training such as community health workers and medical aids Current mental and spreadsheet stock-flow models A stock -and- flow approach to clinical workforce ... Linking health impacts to population and people with health conditions tional status, or any other factor which can affect healthrelated quality of life Healthcare within the overall social structure ... encompasses all facilities and technologies, and also a financial subsystem 'Funds and Support', containing funding and the political support relevant to the clinical professionals' ability to provide...
- 10
- 398
- 0
báo cáo khoa học: " The NIHR collaboration for leadership in applied health research and care (CLAHRC) for Greater Manchester: combining empirical, theoretical and experiential evidence to design and evaluate a large-scale implementation strategy" pptx
... systemically shared, collected, and analysed to add to the wider knowledge base about effective implementation As highlighted above, each pair of KTAs is linked to a clinical and academic lead and ... engagement of clinical opinion leaders, the quality of relationships, change and project management capacity, senior management support, organizational complexity, and a climate of organizational ... that it allows, its focus on incremental improvement, and a special emphasis on planning for spread and sustainability of change Due to its universality and flexibility, this approach can be applied...
- 12
- 295
- 0
báo cáo khoa học: " Evaluating the effectiveness of a tailored multifaceted performance feedback intervention to improve the quality of care: protocol for a cluster randomized trial in intensive care" pps
... but separate, basic quarterly and annual feedback reports containing data on the extended indicator set Also, support by the NICE data managers is available and includes data quality audits, support ... outcome and length of stay for admissions to adult general critical care units in England, Wales and Northern Ireland: the Intensive Care National Audit & Research Centre Case Mix Programme Database ... uses a framework for data quality assurance [32], including elements like periodical on-site data quality audits and automated data range and consistency checks For each ICU, additional data checks...
- 10
- 421
- 0
Báo cáo y học: " An integrated approach to diagnosis and management of severe haemoptysis in patients admitted to the intensive care unit: a case series from a referral centre" ppsx
... treatment in 209 cases of relapse hemoptysis Angiology 1993, 44:295-299 Tanaka N, Yamakado K, Murashima S, Takeda K, Matsumura K, Nakagawa T, Takano K, Ono M, Hattori T: Superselective bronchial ... embolotherapy for control af acute hemoptysis Chest 1999, 115:912-915 Analysis and interpretation of data: Fartoukh, Parrot, Mayaud, Cadranel Drafting of the manuscript: Fartoukh, Parrot, Carette, Khalil ... Initial management and short-term outcome Initial management and short-term outcome †Life sustaining therapy was withheld/withdrawn in 2/46 patients managed conservatively and in 10/147 patients...
- 9
- 461
- 0
Báo cáo y học: "Comparison of cooling methods to induce and maintain normoand hypothermia in intensive care unit patients: a prospective intervention study" ppsx
... international standards All patients were intubated and mechanically ventilated If necessary, patients were sedated using midazolam and/ or propofol to a Ramsay score of and received adequate analgesia with ... additional cooling No alternative cooling was used in the patients allocated to conventional cooling Standard care All patients were admitted to the ICU, monitored and treated according to international ... third smaller blanket under the patient's head The large blankets have of 1.1 m2 each, the smaller blanket a surface area of 0.15 m2, and all are connected to an automatic temperature control...
- 9
- 462
- 0
Báo cáo y học: "Very old patients admitted to intensive care in Australia and New Zealand: a multi-centre cohort analysis" pptx
... Development and implementation of a high-quality clinical database: the Australian and New Zealand Intensive Care Society Adult Patient Database J Crit Care 2006, 21:133-141 25 Australian and New Zealand ... Intensive Care Society Adult Patient Database 2001 to 2005 (a) Mean and standard deviation Acute Physiology and Chronic Health Evaluation (APACHE) II and nonage APACHE II scores (b) Crude mortality with ... intensive care unit admissions for patients aged ≥ 80 admissions for patients aged ≥ 80 years years from the Australian and New Zealand Intensive Care Society Adult Patient Database 2001 to 2005 Page...
- 14
- 250
- 0
Báo cáo y học: "A pilot study on peritraumatic dissociation and coping styles as risk factors for posttraumatic stress, anxiety and depression in parents after their child''''s unexpected admission to a Pediatric Intensive Care Unit" ppt
... from January 2006 to March 2007 Standardized transfer, aftercare program and procedure This follow-up study is part of the standard aftercare program of the department of Pediatric Intensive Care ... child at PICU for which adequate psychological support is necessary Avoidance coping, passive reaction pattern and particularly peritraumatic dissocation were associated with mental health problems ... research after cancer, and in general stress literature as well [12,26] Once again, this association may reflect a shared, underlying construct, or it may indicate a causal relationship with...
- 9
- 315
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25