a fast changing ecosystem under human pressure
Game changer how companies are responding to a fast changing business environment
... that is changing faster and faster, it means you have to make more calls and start experimenting You need to fail fast, fail quickly, and fail cheaply Rolf Bixner, Senior partner and managing director, ... you are in an environment that is changing faster and faster, it means you have to make more calls and start experimenting,” says Mr Bixner “You need to fail fast, fail quickly, and fail cheaply.” ... for that decline,” says Mr Gilbert “With two separate companies, I can manage change in an old legacy organisation and manage innovation in a new, hyper-growth company at the same time.” Having...
- 18
- 214
- 0
JUNGLE RUBBER: A TRADITIONAL AGROFORESTRY SYSTEM UNDER PRESSURE docx
... Landai, Suka Damai, Malapari, Napal Sisik, Pelayangan, Rantau Kapas Mudo and Tuo), indicated that about 47% farmers undertake gap replanting in at least one of their rubber gardens (Wibawa et al., ... tradisonal di Propinsi Jambi, Sumatera Report submitted to ICRAF SEA Wibawa G, Boutin D and Budiman AFS 200 0a Alternatif pengembangan perkebunan karet rakyat dengan pola wanatani Proc Lokakarya dan ... intensitas cahaya ) Skripsi S2, Institut Pertanian Bogor, Indonesia: 115 pp Sanjaya KR 2001 Studi pengaruh bukaan tajuk pada regenerasi karet (Hevea brasiliensis Muell Arg.) secara alami pada sistem Agroforest...
- 48
- 303
- 0
Báo cáo khoa học: "Growth and fructification of a Norway spruce (Picea abies L. Karst) forest ecosystem under changed nutrient and water input" doc
... those parameters which have a strong effect on the ecosystems among a number of varying factors In order to avoid these disadvantages, ecosystems as a whole or at least representative parts have ... h/d ratio, the quotient calculated from tree height and DBH used to determine the stand stability, showed a favourable average value of 73 The average annual increment was m3 ha–1 yr–1 Almost all ... storage tanks and after a drought phase normally lasting for several months sprinkled under the roof over the space of a few days (table II) The average amount of sprinkled water was 10 dm3 m–2 day–1...
- 10
- 178
- 0
Báo cáo lâm nghiệp: "Changing electrophoretic patterns of glutamate dehydrogenases and aspartate aminotransferases in a few tree species under the influence of ectomycorrhization" potx
... cells and fungal hyphae revealed identical isoforms, while no activity was found in the peri- pheral mycelial layer (Table II) Conclusion In all the associations investigated, fungal AAT was strongly ... Hebeloma sp a high level of NADP-GDH activity was found, whereas only NAD-GDH activity was detected in non-mycorrhizal roots In the association spruce-Hebefoma, both activities were present (Table ... beech (Fagus sylvatica L.) New Phytol 111, 683-692 Khalid A. , Boukroute A. , Botton B & Martin F (1988) The aspartate aminotransferase of the ectomycorrhizal fungus Cenococcum geophilum: purification...
- 3
- 240
- 0
A Fast File System for UNIX
... the allocated space The problem with expanding a file one fragment at a a time is that data may be copied many times as a fragmented block expands to a full block Fragment reallocation can be minimized ... insufficient space to hold the new data) If space exists in a block already allocated, the space is filled with new data If the remainder of the new data contains more than a full block of data, a full ... fragments and a single unused fragment This remaining fragment can be allocated to another file as needed Space is allocated to a file when a program does a write system call Each time data is written...
- 14
- 1,023
- 0
DMF Decomposition and Nitrogen Removal Performance by a Mesh-Filtration Bioreactor under Acidic Conditions
... of metabolically active bacteria in activated sludge, Microbial Environ., 19, 61- 70 [15] American Public Health Association, American Water Works Association and Water Environmental Federation, ... (2005) Standard method for examination of water and wastewater, 21st ed [16] Japanese Standards Association (1998) Japanese Industrial Standards, JIS K0102 [17] Tarre, S., Beliavski, M., Denekamp, ... nitrification and denitrification at pH than activated sludge, suggesting that acidophilic heterotrophic and nitrifying bacteria had become acclimated in the reactor Characterization of the unique bacteria...
- 8
- 433
- 0
Tài liệu Chapter 19. Mail and Address Book Email is a fast, cheap, convenient communication medium. pptx
... a fifth kind, but if you follow the instructions at http://members.aol.com/adamkb/aol/mailfaq/imap/applemail.html, you can read your AOL mail as if it came from a regular IMAP account.) POP accounts(Post ... they're easy to set up and maintain, and because they offer many of the same features as IMAP servers Luckily, Mail can read and send email through Exchange servers as though your Mac were just another ... (Your Mac.com account is an IMAP account, which is why you can access the mail in your Inbox repeatedly from any Mac in the world, anywhere you go You can opt for a Gmail account to be an IMAP account,...
- 5
- 383
- 0
Tài liệu Báo cáo khoa học: "A Finite-State Model of Human Sentence Processing" docx
... using a parallel beam-search parsing technique based on the stochastic context-free grammar (SCFG) and subcategorization probabilities Crocker and Brants (2000) used broad coverage statistical parsing ... increasing ambiguity so that other ambiguity types also can be disambiguated in a similar way via lexical category disambiguation This idea has been explored as one of the lexicalist approaches to ... parameters until additional parameters are demanded by data Equally important, the quality of architectural simplicity should be maintained Among the different sources of information manipulated...
- 8
- 446
- 0
Tài liệu Báo cáo khoa học: "A Fast, Accurate Deterministic Parser for Chinese" pdf
... work was supported in part by ARDA’s AQUAINT Program We thank Eric Nyberg for his help during the final preparation of this paper David M Magerman 1994 Natural Language Parsing as Statistical Pattern ... times faster than Levy and Manning’s parser, and 270 times faster than Bikel’s parser Another advantage of our parser is that it does not take as much memory as these other parsers In fact, none ... the stack into one IP node, and outputs this as a partial parse Sagae and Lavie (2005) have shown that this algorithm has linear time complexity, assuming that classification takes constant time...
- 8
- 390
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... Slovak Science and Technology Assistance Agency (APVT) Grant 26-002102 and the Slovak Grant Agency (VEGA) 2/3087/23 (to ¨ K L.) The authors thank O Wrange for recombinant human NF1 and N Tanese ... Neckelmann, N., Li, K., Wade, R.P., Shuster, R & Wallace, D.C (1987) cDNA sequence of a human skeletal muscle ADP/ATP translocator: Lack of a leader peptode, divergence from a fibroblast translocator...
- 8
- 426
- 0
Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot
... Hata, T., Hayashi, R & Doi, E (1967) Purification of yeast proteinases Part III Isolation and physicochemical properties of yeast proteinase A and C Agric Biol Chem 31, 357–367 Aibara, S., Hayashi, ... or was obtained from Oriental Yeast Co (Lot 21003805) (Osaka, Japan) and proCPY was prepared as the same manner as CPY, with minor modifications Dgly CPY and Dgly proCPY, in which the asparagine ... contrast to the two-state transition of the precursor form, mature CPY showed a multistate transition: a first transition in the 0.1–150 MPa range, a second from 150 to 450 MPa, and a third at pressures...
- 7
- 439
- 0
Báo cáo khoa học: Recent insights into cerebral cavernous malformations: a complex jigsaw puzzle under construction doc
... proteins in vascular integrity An increasing amount of data indicates that CCM proteins are connected to the plasma membrane and regulate cell–cell adhesion, cell shape and polarity, and most likely ... complex as a scaffold for the Rho family GTPases RhoA, Rac and Cdc42, and for mitogen-activated protein kinase (MAPK) and Ser ⁄ Thr kinases These proteins regulate endothelial cell shape and polarity ... KRIT1, a gene mutated in cerebral cavernous malformation, encodes a microtubule-associated protein Proc Natl Acad Sci U S A 99, 10677–10682 Boulday G, Blecon A, Petit N, Chareyre F, Garcia LA, Niwa-Kawakita...
- 13
- 381
- 0
Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc
... and bacterial, protease contamination Protein concentration was determined with a Bio-Rad protein assay kit using BSA as a standard according to the manufacturer’s protocol Any bacterial and protease ... the appearance of a significant deacylation activity Any bacterial contamination of our protein preparations that might be responsible for activation of the PLB precursor at prolonged storage was ... staining as described in Materials and methods Marker proteins and their corresponding molecular masss are indicated in lane Lane 2, material from the acid extracts of granules; lane 3, material...
- 12
- 486
- 0
Báo cáo khoa học: ERS1 encodes a functional homologue of the human lysosomal cystine transporter pptx
... meh1D and vma1D cells imaged in (A) mutant strains that are defective in the vacuolar (H+) ATPase (V-ATPase) that pumps protons into the lumen ([17] and Fig 5) We qualitatively measured vacuolar acidification ... USA 92, 1287– 1291 Gaxiola RA, Rao R, Sherman A, Grisafi P, Alper SL & Fink GR (1999) The Arabidopsis thaliana proton transporters, AtNhx1 and Avp1, can function in cation detoxification in yeast ... those amino acids that are invariant in an alignment of representative cystinosin-related proteins from humans (AAH32850.1), birds (Gallus gallus; XP_415851.1), flies (Drosophila melanogaster; AAM50956.1),...
- 15
- 378
- 0
Báo cáo khoa học: "Paragraph-, word-, and coherence-based approaches to sentence ranking: A comparison of algorithm and human performance" ppt
... MSWord summarizer was to have a more useful baseline for scalable sentence rankings than the paragraph-based approach provides NoParagraph mean rank correlation coefficient WithParagraph 0.6 0.5 ... compare human rankings to the paragraph-based baseline approach, we calculated point biserial correlations (cf Bortz (1999)) We obtained significant correlations between paragraph-based rankings ... paragraph as important, and the other sentences as not important We included this approach merely as a simple baseline 2.2 Word-based approaches Word-based approaches to summarization are based...
- 8
- 415
- 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... PCR amplification of the Hsp9 0a ORF using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT ... kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains...
- 11
- 427
- 0
Báo cáo khoa học: A L225A substitution in the human tumour suppressor HIC1 abolishes its interaction with the corepressor CtBP docx
... GACCTGGCCACTGTGGAATTCTGTGATGCACAG; mCtBP2 .A5 8E.R, CTGTGCATCACAGAATTCCACAGT GGCCAGGTC; mCtBP2.V72R.F, GAAATCCATGAGA AGCGGTTGAATGAAGCTGTG; and mCtBP2.V72R.R, CACAGCTTCATTCAACCGCTTCTCATGGATTTC) BglII- and SalI-digested mutant ... generated by PCR as described above with the same sense oligonucleotide and an antisense oligonucleotide containing an SstI site 5¢-AT GCACACACGTAAGGCACTCAGCTGAGATCTCGAG3¢ The BamHI–KpnI and BamHI–SstI ... 5¢-GGAATT HIC1 interacts with CtBP CGGGATCCCAAAGTACTGCCACCTGCGG-3¢ with a BamH1 site, and antisense 5¢-AGTGGTACCGTCGACTC ATCCCGGGCTGCCGCT-3¢, with a KpnI site The Gal4HIC1 135–422 wt and L22 5A were...
- 12
- 326
- 0
HMDB: A Large Video Database for Human Motion Recognition pdf
... to-date the largest and perhaps most realistic available dataset Each clip was validated by at least two human observers to ensure consistency Additional meta information allows for a precise selection ... J Ahmed, and M Shah Action mach: A spatiotemporal maximum average correlation height filter for action recognition CVPR, 2008 [17] B Russell, A Torralba, K Murphy, and W Freeman Labelme: a database ... performance of representative state-of-the-art computer vision algorithms with accuracy about 23%, this dataset is arguably a good place to start (performance on the CalTech-101 database for...
- 8
- 469
- 0
A fast quantum mechanical algorithm for database search pptx
... the Walsh-Hadamard transformation and other state transition matrices, the probability in each state stays the same since the square of the absolute value of the amplitude in each state stays ... (this is a phase rotation and hence a valid quantum mechanical operation as discussed in the last paragraph of section 1.2) Then the inversion about average operation is carried out This increases ... operation both of which are relatively easy as compared to operations required for other quantum mechanical algorithms [BCDP96] (ii) Quantum mechanical algorithms based on the Walsh-Hadamard transform...
- 8
- 389
- 1
Báo cáo khoa học: "A Fast and Accurate Method for Approximate String Search" pptx
... Uncertainty in AI (UAI) Stoyan Mihov and Klaus U Schulz 2004 Fast approximate search in large dictionaries Comput Linguist., 30:451–477, December Naoaki Okazaki, Yoshimasa Tsuruoka, Sophia Ananiadou, ... Conference on Empirical Methods in Natural Language Processing and Computational Natural Language Learning, pages 181–189 Andrew R Golding and Dan Roth 1999 A winnowbased approach to context-sensitive ... in research on approximate string search: (1) how to build a model that can archive both high accuracy and efficiency, and (2) how to develop a data structure and algorithm that can facilitate efficient...
- 10
- 507
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose