a disintegrin and metalloproteases involvement in aortic aneurysm pathogenesis
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc
Ngày tải lên :
12/08/2014, 16:20
... ACGTTGGATGAATCCCCGCAGACCATGACAC fwd ACGTTGGATGAGTCGGTAGCAACACCAGG rev ACGTTGGATGACCATGACACCTTCCTGCTG fwd ACGTTGGATGGGAGTGAAAAGATGTGCTGG rev ACGTTGGATGCCACTTCCTCTGCACAAATC fwd ACGTTGGATGAGAGAACTGGGTTAAGGCAG ... Primer Callrate (%) fwd ACGTTGGATGAAAATACTGGGACTCGAGGC rev ACGTTGGATGTGCTGTATCTATAGCCCTCC fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC ... ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC fwd ACGTTGGATGCTGCCCTTGATGATTCCAAG rev ACGTTGGATGGGAACATCACAGGAAATGAC fwd ACGTTGGATGTTCCCTTCTCCCTTCCCTCTC rev ACGTTGGATGTTGCTCAGCCCCAAAGATGG fwd ACGTTGGATGTTCCCTTCTCCCTTCCCTCTC...
- 12
- 355
- 0
Báo cáo y học: "A knowledge synthesis of patient and public involvement in clinical practice guidelines: study protocol" doc
Ngày tải lên :
11/08/2014, 05:21
... patients and the public in a more meaningful and effective way The Canadian Medical Association, in its 2007 handbook on clinical practice guidelines, notes that patient and public involvement is 'increasingly ... The main decision-makers and stakeholders of this knowledge synthesis are patients, public, government, and health professional organizations in Canada and abroad that are interested in, or affected ... qualitative analyses to support data collection, organization, and analysis Phase three: Synthesize evidence and draw conclusions Both publication and interview data will be analyzed A research...
- 8
- 395
- 0
báo cáo khoa học: " A knowledge synthesis of patient and public involvement in clinical practice guidelines: study protocol" ppsx
Ngày tải lên :
11/08/2014, 16:20
... patients and the public in a more meaningful and effective way The Canadian Medical Association, in its 2007 handbook on clinical practice guidelines, notes that patient and public involvement is 'increasingly ... The main decision-makers and stakeholders of this knowledge synthesis are patients, public, government, and health professional organizations in Canada and abroad that are interested in, or affected ... qualitative analyses to support data collection, organization, and analysis Phase three: Synthesize evidence and draw conclusions Both publication and interview data will be analyzed A research...
- 8
- 420
- 0
Báo cáo khoa học: Identification and characterization of 1-Cys peroxiredoxin from Sulfolobus solfataricus and its involvement in the response to oxidative stress pdf
Ngày tải lên :
07/03/2014, 12:20
... 12 Kawakami R, Sakuraba H, Kamohara S, Goda S, Kawarabayasi Y & Ohshima T (2004) Oxidative stress response in an anaerobic hyperthermophilic archaeon: presence of a functional peroxiredoxin in ... dehydrogenase (150 kDa), BSA (65.4 kDa), ovalbumin (48.9 kDa), chymotrypsinogen (22.8 kDa) and the RNAse A (15.6 kDa) were used as molecular weight standards Analytical methods for protein characterization ... using HF Taq DNA polymerase (Roche Applied Science, Monza, Italy) and the following primers: forward primer (the inserted NdeI restriction site is underlined) 5¢-CTAGGTGAACATATGAGTGAGGAAAGAATTCC-3¢...
- 11
- 565
- 0
Báo cáo khoa học: Comprehensive sequence analysis of horseshoe crab cuticular proteins and their involvement in transglutaminase-dependent cross-linking potx
Ngày tải lên :
07/03/2014, 21:20
... Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Unknown Antibacterial Antibacterial Antibacterial Antibacterial Antibacterial Unknown ... chitinbinding proteins in invertebrates J Mol Evol 48, 341– 347 Kawabata S, Nagayama R, Hirata M, Shigenaga T, Agarwala KL, Saito T, Cho J, Nakajima H, Takagi T & Iwanaga S (1996) Tachycitin, a ... 26172–26178 Suetake T, Tsuda S, Kawabata S, Miura K, Iwanaga S, Hikichi K, Nitta K & Kawano K (2000) Chitin-binding proteins in invertebrates and plants comprise a common chitin-binding structural motif...
- 13
- 582
- 0
Báo cáo khoa học: Subcellular localization of yeast Sec14 homologues and their involvement in regulation of phospholipid turnover pptx
Ngày tải lên :
23/03/2014, 18:20
... PGY91 MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa MATa PGY90 MATa ura3, trp1, ... ACATCTGAGTCTAGATATATACGTTTGTGTAGCGGGAAACGTTAAAAAAAAAAATCTTAATTATAGTTTATCGATGAATTCGAGCTCGTTTAAAC GCTCCACCCATCTCTATTGC GGTCAATTTACCGTAAGT TGTCACAAATGTCCATCCAACAGAATACGGCCTTTACATTTTACAAAAACAAATCATCGAGGACGTTGAGGGAGCAGGTGCTGGTGCTG AATATAAGGCAAAAATAAGAAATTATTATAGGGTTTATATAAGAGACTATTATTAGATCATGCCAACAAATCGATGAATTCGAGCTCGTTTAAAC ... CCCTTTTATTGACCCACTGACC AGGTTGGCCATGGAACTGG TGTCGGATTAAGTGAATATGACACCAAGGGCCAACATGACGAATTAAAATATCCTGTTGATATGGTCATTGGAGCAGGTGCTGGTGCTG ACATCTGAGTCTAGATATATACGTTTGTGTAGCGGGAAACGTTAAAAAAAAAAATCTTAATTATAGTTTATCGATGAATTCGAGCTCGTTTAAAC...
- 13
- 430
- 0
Behind the Scenes or, Thirty years a slave, and Four Years in the White House pptx
Ngày tải lên :
29/03/2014, 22:20
... told Mr Garland so, and he gave me permission to see what I could I was fortunate in obtaining work, and in a short time I had acquired something of a reputation as a seamstress and dress-maker The ... he seized a heavy stick and beat me with it in a shameful manner Again I went home sore and bleeding, but with pride as strong and defiant as ever The following Thursday Mr Bingham again tried ... one race bind the other race in chains as strong and enduring as if there had been no Anglo-Saxon taint? By the laws of God and nature, as interpreted by man, one-half of my boy was free, and...
- 112
- 366
- 0
báo cáo hóa học: " Tumor necrosis factor-mediated inhibition of interleukin-18 in the brain: a clinical and experimental study in head-injured patients and in a murine model of closed head injury." pot
Ngày tải lên :
19/06/2014, 22:20
... Yoshinaga M, Ohkawara S, Nariuchi H, McCracken Jr, G.H.: Tumor necrosis factor alpha / cachectin and interleukin beta initiate meningeal inflammation J Exp Med 1990, 172:497-507 Saukkonen K, Sande ... T, Redaelli CA, Trentz O, Shohami E, Stahel PF: Elevated intracranial IL-18 in humans and mice after traumatic brain injury and evidence of neuroprotective effects of IL-18-binding protein after ... were performed in compliance with the guidelines of the Federation of European Laboratory Animal Science Association (FELASA) and approval was granted by the Institutional Animal Care Committee...
- 6
- 436
- 0
Báo cáo y học: "Oesophageal Perforation: A diagnostic and therapeutic challenge in a resource limited setting. A report of three cases." ppsx
Ngày tải lên :
10/08/2014, 09:22
... odynophagia since the incident which was 15 days ago There was an associated swinging fever, malaise and anorexia On examination, he was wasted very ill looking and drooling foul smelling saliva from ... enteral route, chest physiotherapy was continued and ambulation was encouraged After two weeks, a barium oesophagram was done and showed no leak, oesophageal healing was confirmed Oral feeding was ... examination; the right side had features of an effusion with no air entry He had normal cardiovascular exam, save for a tachycardia of 112 bpm in sinus rhythm The abdominal exam was also normal...
- 5
- 381
- 0
Báo cáo y học: "A novel and safe technique in closed tube thoracostomy" pdf
Ngày tải lên :
10/08/2014, 10:20
... indication is placed into the pleural space with the help of a macro clamp and connected to an underwater drainage system Finally, a U-suture is made for use in drain fixation and removal Statistical ... hand, angulation of the drain in surgical technique is not a rare occasion In such cases, poor drainage may be associated with the angulation point and the degree of angulation of the drain because ... was advanced towards the pleural space and directed to the apex After the combination was advanced about 15 cm, the trocar was withdrawn about 10 cm, and thus, the free end of the drain was advanced...
- 4
- 428
- 0
Báo cáo y học: " Axillary silicone lymphadenopathy presenting with a lump and altered sensation in the breast: a case report" pot
Ngày tải lên :
11/08/2014, 17:21
... implants or silicone injection [1, 6] When associated with breast augmentation, it primarily affects the axillary nodes but cases have been reported involving intramammary, internal mammary and ... contributions STA was the primary author of the manuscript; JC provided critical appraisal and re-writing of initial drafts of the manuscript, and provided the radiological imaging and legends SR was the ... tissue and autoimmune diseases and human adjuvant disease [4, 8, 9] At present, the mechanism of such complications is uncertain and in some cases, proof of such a relationship remains a source...
- 5
- 264
- 0
Báo cáo y học: " Breast conserving surgery with preservation of the nipple-areola complex as a feasible and safe approach in male breast cancer: a case report" pptx
Ngày tải lên :
11/08/2014, 23:21
... Abbreviations ANC: axillary node clearance; BCS: breast conserving surgery; DCIS: ductal carcinoma in situ; FBC: female breast cancer; FNA: fine needle aspiration; IDC: invasive ductal carcinoma; ... initial manuscript DJH performed the initial operation, and organised the primary management plan of the patient He supervised the writing and editing of the paper All the authors have read and ... and a mammogram demonstrated a cm suspicious lesion, which was found to be cancer on both fine needle aspiration (FNA) and core biopsy The tumour was a grade invasive ductal carcinoma (IDC) Investigations...
- 3
- 275
- 0
Báo cáo y học: "Lung epithelium as a sentinel and effector system in pneumonia – molecular mechanisms of pathogen " pdf
Ngày tải lên :
12/08/2014, 16:20
... involved in agonist recognition, whereas the central NOD (NACHT) domain has ATPase activity and facilitates self-oligomerization At the amino-terminal a protein-protein interaction mediating caspase-recruitment ... J: MORAXELLA CATARRHALIS INDUCES INFLAMMATORY RESPONSE OF BRONCHIAL EPITHELIAL CELLS VIA MITOGEN-ACTIVATED PROTEIN KINASE AND NF{kappa}B ACTIVATION AND HISTONE DEACETYLASE Page 15 of 17 (page number ... RIP1 and TRAF6 stimulates NF-κB IL-1R domain-containing adaptor protein; Mal), TRIF (Toll/IL-1R domain-containing adaptor inducing IFNβ) and TRAM (Fig 3) Thus, whereas all TLRs except TLR3 engage...
- 17
- 287
- 0
the essence of a university and scholarly activity in accounting, with reference to a department of accounting at a south african university
Ngày tải lên :
04/11/2014, 22:20
... study, as stated at the start of this article, was to reveal the increasing academic tension that has arisen in Departments of Accounting (including the Auditing, Taxation and Financial Management ... Accounting It can therefore be assumed that the academic training of accountants in general, and later prospective chartered accountants in particular, was the main academic focus, as it was at all the ... Association (AAA) Committee on Concepts and Standards for External Financial Reports 1977 Statement on accounting theory and theory acceptance Sarasota, Fla: American Accounting Association Babbie,...
- 26
- 380
- 0
Characterization the role of kinectin in assembly of translation elongation complex to endoplasmic reticulum and its involvement in organelle motility
Ngày tải lên :
12/09/2015, 10:00
... mRNA adenine Aplastic anemia antibody activation domain amyloid precursor protein adenine triphosphate binding domain base pair bovine serum albumin cytosine circular dichroism complementary DNA ... conventional kinesin (Kifs 5) using in vitro and in vivo assays (Ong et al., 2000) The kinesin-binding domain on kinectin can enhance the microtubule-stimulated ATPase activity and inhibit the kinesin-dependent ... dyneins are involved in a variety of intracellular motile processes including maintenance of Golgi apparatus and trafficking of membraneous vesicles and other intracellular particles (Holzbaur...
- 295
- 359
- 0
Wireshark: Determining a SMB and NTLM version in a Windows environment
Ngày tải lên :
17/11/2015, 09:36
... with default settings it will always use NTLMv1 If we use an Windows or Vista client and a windows 2008 R2 server it will use NTLMv2 Lets fire up Wireshark and take a look what’s happening “on ... for authentication and thus insecure We need to change this so the XP machines will authenticate by using NTLMv2 We can achieve this by change the Lmcompatibilitylevel value to The best way to achieve ... while using Wireshark This is very useful to know because it has a great impact on your security There are many documents on the internet that show that LM and NTLMv1 are insecure these days therefore...
- 16
- 375
- 0
Ascites and Renal Dysfunction in Liver Disease Pathogenesis, Diagnosis, and Treatment docx
Ngày tải lên :
14/08/2014, 19:20
... exogenous and endogenous chemical substances, including capsaicin, phenyldiguanidine, bradykinin, substance P, and prostaglandins (34–36) Since substances such as bradykinin and prostaglandins may circulate ... to AII and may play a role in activating NOS and generating cGMP (161) Renal kallikrein–kinin system Kallikreins exist in two major types: plasma and glandular (162) Kallikreins, which are serine ... kallikrein and kinin excretion (173) Bradykinin activates phospholipase A2 leading to increased prostaglandin generation, and bradykinin is also a stimulus for eNOS leading to increased NO generation...
- 454
- 399
- 1
Determinants of male involvement in maternal and child health services in sub-Saharan Africa: a review potx
Ngày tải lên :
22/03/2014, 12:20
... Byamugisha R, Astrom AN, Ndeezi G, Karamagi CA, Tylleskar T, Tumwine JK: Male partner antenatal attendance and HIV testing in eastern Uganda: a randomized facilitybased intervention trial J Int ... survey and clinical data Lancet 2008, 371:2183–2191 Matovu JK, Makumbi FE: Expanding access to voluntary HIV counselling and testing in sub-Saharan Africa: alternative approaches for improving uptake, ... http://www.who.int/hiv/en/ 17 Aluisio A, Richardson BA, Bosire R, John-Stewart G, Mbori-Ngacha D, Farquhar C: Male antenatal attendance and HIV testing are associated with decreased infant HIV infection and increased...
- 16
- 541
- 0
Báo cáo sinh học: " Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" doc
Ngày tải lên :
19/06/2014, 08:20
... cellular translation HCV NS 4A and NS4B proteins mediate translational inhibition and, perhaps, increased degradation of certain cellular proteins [42,43] In contrast, NS 5A and E2 proteins are reported ... Demkowicz WE, Maa JS, Esteban M: Identification and characterization of vaccinia virus genes encoding proteins that are highly antigenic in animals and are immunodominant in vaccinated humans J Virol ... eukaryotic translation initiation factor and NF-kappaB Mol Cell Biol 1999, 19:4653-4663 Naganuma A, Nozaki A, Tanaka T, Sugiyama K, Takagi H, Mori M, Shimotohno K, Kato N: Activation of the interferon-inducible...
- 19
- 373
- 0
báo cáo hóa học:" Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" docx
Ngày tải lên :
20/06/2014, 04:20
... cellular translation HCV NS 4A and NS4B proteins mediate translational inhibition and, perhaps, increased degradation of certain cellular proteins [42,43] In contrast, NS 5A and E2 proteins are reported ... Demkowicz WE, Maa JS, Esteban M: Identification and characterization of vaccinia virus genes encoding proteins that are highly antigenic in animals and are immunodominant in vaccinated humans J Virol ... eukaryotic translation initiation factor and NF-kappaB Mol Cell Biol 1999, 19:4653-4663 Naganuma A, Nozaki A, Tanaka T, Sugiyama K, Takagi H, Mori M, Shimotohno K, Kato N: Activation of the interferon-inducible...
- 19
- 389
- 0