a disease model in the study of vascular development aberrant vasculogenesis and angiogenesis
A new direction in the study of the orientation number of a graph
... ie aj → B ∗ Th e n d( b∗ , aj ) ≤ fo r a ll b∗ ∈ B ∗ im p lie s B ∗ → a; a n d fo r a ll al ∈ A \ {aj }, d( al , aj ) ≤ im p lie s al → a Th is m e a n s t h a t A = {aj } a n d A = A \ {aj ... h a p t e r b y e xa m in in g t h e family o f g r a p h s ( r a t h e r t h a n ju s t a particular g r a p h ) o b t a in e d b y a d d in g p e d g e s b e t we e n Kp a n d Cp in a n a ... o t a c o -p a ir Fo r e a c h bi ∈ B, le t Si = O( bi ) ∩ A W e a ls o le t A = {ai |ai → a in F } a n d A = A \ A L ike wis e , B = {bj |bj → b in F }, B = B \ B , A = {ai |b → in F } a n...
- 226
- 350
- 0
Báo cáo " A numerical model for the simulation of wave dynamics in the surf zone and near coastal structures " pot
... computational time and at the moment is not suitable for a practical application. On the other hand, based on results of Nadaoka et al [9], Ting and Kirby [15‐17], it can be estimated ... wave breaking on a natural beach To verify the accuracy of the numerical model on the simulation of the wave transformation on a natural beach, existing experimental data on the wave dynamics in ... wave dynamics in the near shore area and in the vicinity of coastal structures. It has been found that the numerical model can satisfactorily simulate the wave transformation, ...
- 11
- 460
- 0
Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt
... times a week In the summer and autumn season, the observations are carried out once a week The ordinal number of a day from the beginning of the calendar year was assigned to the date of particular ... herbs can also occur Phenological data are a certain expression of the climate character of a given region Thus, they can contribute to assess the variability of weather and also to evaluate the ... The earlier beginning of this stage can be explained by the fast onset of high spring temperatures in 2006 and by very mild winter and extraordinarily warm spring in 2007 The beginning of leaf...
- 12
- 386
- 0
Báo cáo khoa học: " A predictive model for the level of sIgA based on IgG levels following the oral administration of antigens expressed in Sacchromyces cerevisiae" pdf
... erew slamina llA )aeroK ,ytisrevinU lanoitaN luoeS( slamina yrotarobal fo esu dna erac eht rof snoitaluger dna ycilop gniwollof yduts siht tuohguorht desu erew )aeroK ,ytisrevinU lanoitaN luoeS ... ,retneC laminA yrotarobaL( ecim elamef c/BLAB dlo-keew-eviF snoitcelloc elpmas dna noitazinummi ,slamina latnemirepxE ]91,81[ yduts siht ni eniccav laro na sa desu dna debircsed ylsuoiverp sa deraperp ... snoitaraperp eniccaV sdohteM dna slairetaM GgI cimetsys dna AgIs lasocum neewteb pihsnoitaler eht gnizylana yb seneg AIIxpa dna AIxpa gnisserpxe )eaisiverec S( eaisiverec secymorahccaS htiw noitazinummi...
- 5
- 443
- 0
báo cáo khoa học: " A new model for the characterization of infection risk in gunshot injuries:Technology, principal consideration and clinical implementation" pptx
... bullets Infiltration depth of barium titanate particles in the temporary cavity The radiological examination of the infiltration depth of barium titanate particles within the ruptures of a temporary ... conceived of the work and participated in its design and coordination CS and MR made substantial contributions to data acquisation and conception of manuscript CS and MR drafted and designed the manuscript ... wound contamination with radio-opaque barium titanate particles is a simple and reproducible method of systematic examination in the field of terminal ballistics The model permits the infiltration...
- 5
- 573
- 0
A STUDY ON GRADE 10 TH STUDENTS’ PERCEPTIONS TOWARDS LEARNING TO READ ENGLISH AT A HIGH SCHOOL IN THE NORTH OF VIETNAM
... not high In fact, there are many factors affecting reading results, two of them are pleasure reading habits and attitudes towards reading The study by Robb and Kano (2013) show that 84% of students ... Year pupils between 1998 and 2003 Additionally, reading habit of students in Social Sciences and Arts at Rajshahi university have been declined (Eamin Ali Akanda, Hoq & Hasan, 2013).These researchers ... http://nflrc.hawaii.edu/rfl/October2003/waring/waring.html Yamashita, J (2004) Reading attitudes in L1 and L2, and their influence on L2 extensive reading Reading in a Foreign Language, 16, 1–19 Yamashita, J (2007) The relationship...
- 63
- 587
- 1
Development of a novel toll like receptor based two hybrid assay for detecting protein protein interactions and its application in the study of CD14 dimerization and FcyRIIA activation
... regulators of IRF-3 activation in the MyD88-independent pathway 23 Figure 1.8 TIR domain-containing adaptors and TLR signaling MyD88 is an essential TIR domain-containing adaptor for the induction ... induction of inflammatory cytokines via all the TLRs TIRAP/Mal is a second TIR domain-containing adaptor that specifically mediates the MyD88-dependent pathway via TLR2 and TLR4 In the TLR4 and TLR3mediated ... TAB1, and is essential for IL-1 and TNF-α induced NF-κB activation (Jiang et al., 2002) Interaction of the IRAK4/IRAK1/TRAF6 and TAK1/TAB1/TAB2 complexes induces phosphorylation of TAB2 and TAK1,...
- 236
- 494
- 0
Focus - A simplicity manifesto in the Age of Distraction
... struggles we face these days, from being productive and achieving our goals, to getting healthy and fit in the face of fast food and inactivity, to finding simplicity and peace amidst chaos and confusion ... as they are now Ringing phones are one thing, but email notifications, Twitter and Facebook messages, an array of browser tabs open, and mobile devices that are always on and always beeping are ... an email or chatting In fact, it’s almost impossible to these things and create at the same time Sure, you can switch back and forth, so that you’re creating and engaging in any of these activities...
- 121
- 552
- 1
A further contribution to the study of the mortuary customs of the North American Indians docx
... layer of Dall] There are some crania found by us in the lowermost part of the Amaknak cave and a cranium obtained at Adakh, near the anchorage in the Bay of Islands These were deposited in a ... brought and placed around the feet and legs of the horse, and gradually laid up to its sides, and at last over the back and head of the unsuspecting animal, and last of all over the head and even the ... resting-place of a great chief, known as Karkhayahouchak Last year the captain was in the neighborhood of Kagamale in quest of sea-otter and other furs, and he bore up for the island, with the intention...
- 108
- 604
- 0
ENVIRONMENTAL INDICATORS: A SYSTEMATIC APPROACH TO MEASURING AND REPORTING ON ENVIRONMENTAL POLICY PERFORMANCE IN THE CONTEXT OF SUSTAINABLE DEVELOPMENT pot
... sustainability Pearce suggests focusing on savings rates and argues that sustainability in the weak sense means that the value of savings must at least equal the depreciation of manufactured capital ... are aggregated first under each attribute and then into a single Approximated Sustainability Index But the indicators of each attribute appear to be assigned somewhat arbitrarily and the attributes ... Planning and Development Collaboration International and the World Conservation Monitoring Centre, African Data Sampler: An Internationally Comparable Map and Georeferenced Data Base (WRI, Washington,...
- 58
- 698
- 0
PHYSICAL TECHNIQUES IN THE STUDY OF ART, ARCHAEOLOGY AND CULTURAL HERITAGE VOLUME 1 pdf
... micrometres for the analysis, associated with concentration mapping software Some examples using SEM are: the examination and analysis of painting materials in cross sections, the determination of multi-component ... V Lazic, R Fantoni, F Colao, A Santagata, A Morone, Quantitative laser induced breakdown spectroscopy of ancient marbles and corrections for the variability of plasma parameters and of ablation ... Chemical physical characterization of materials of archaeological and artistic interest in: Proc Congress: Science and Technology for the Safeguard of the Cultural Heritage in the Mediterranean Basin,...
- 235
- 487
- 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx
... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A ... B1 A th aliana CaU GT1 C ro seu UG s T7 1C UG 1A T7 th UG alia 1D T8 na UG A 8A T7 th 2E ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A UG T76 C UGT7 A1 CAO69089 V vinifera...
- 11
- 661
- 0
RECENT DEVELOPMENTS IN THE STUDY OF RECRYSTALLIZATION pdf
... textures of the chemically thinned rolled surface layer and the center layer after annealing at 750 oC for h showed that the texture of the surface layer was almost the same before and after annealing ... function of annealing time at 300 and 400 oC These values are based on EBSD measure ments The aspect ratio of grain shape was in the range of 1.5 - 2, which is little influenced by annealing time and ... latest research and methods in a variety of fields where recrystallization is studied and is an important factor Perhaps the main advantage of a new look at these fields is the rapid increase in modern...
- 232
- 677
- 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx
... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... splice variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, ... Supplementary material The following supplementary material is available online: Fig S1 Comparison of human and Rhesus monkey PKA Cb amino acid sequence This material is available as part of the online...
- 13
- 344
- 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt
... (Kirkegaard and Perry, Gaithersburgh, MD, USA) per well The plate was incubated in the dark for 20 and the reaction stopped by the addition of 50 lL of 0.5 M sulfuric acid The plate was read on a Labsystems ... and one for TNF -a The level of U 1A mRNA was similar in all samples as shown in Fig 4A This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription inhibitor There ... identification After drying the plates, lipids were lightly stained with I2 vapor and their positions marked Once the I2 had evaporated, individual lipid bands were scraped into scintillation vials and...
- 7
- 322
- 0
báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx
... Boundary Value Problems The class of problems 1.1 appears in many nonlinear phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3 , in the generalized reaction-diffusion ... no 2, pp 498–505, 1996 13 A V Lair and A W Shaker, “Classical and weak solutions of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications, vol 211, no 2, pp ... Methods & Applications, vol 10, no 1, pp 55–64, 1986 12 A V Lair and A W Shaker, “Entire solution of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications,...
- 16
- 438
- 0
ADVANCES IN THE STUDY OF GENETIC DISORDERS potx
... Disease Autosomal dominant ATP2C1 Adenosine deaminase deficiency Thalassemia Alstrom Syndrome Tangier Disease Phenylketourea Autosomal recessive ADA globins ALMS1 ABCA1 PAH Galactosemia GALT Aicardi-Goutieres ... cousin of the type mother’s brother’s daughter, and particularly in the states of Andhra Pradesh, Karnataka and Tamil Nadu uncle-nice marriages are also widely contracted (Table 1) Buddhism and ... First-cousin marriage had a widespread acceptance among the upper middle class of Victorian England in such a way that the firstcousin marriage of Charles and Emma was not unusual in that time In fact,...
- 484
- 385
- 0
THE IMPORTANCE OF BIOLOGICAL INTERACTIONS IN THE STUDY OF BIODIVERSITY pdf
... Europe Americas Americas Asia Asia Australia-Pacific Asia Africa Asia Asia Asia Australia-Pacific Africa Asia Africa Asia Americas Asia Asia Asia (12), Americas (5), Africa (3), Australia-Pacific ... Diseases and Environmental Change 31 in the Hawaiian Islands, Madagascar, several small islands in the south-western Indian Ocean and various islands in Polynesia and other regions of the Pacific, ... outside Africa, such as Southeast Asia and Central/South America for An gambiae and Middle East and Canary Islands for An arabiensis, although it was this latter species that invaded the north-eastern...
- 402
- 575
- 1
Báo cáo lâm nghiệp: "Variation in the composition and content of ellagitannins in the heartwood of European oaks (Quercus robur and Q petraea). A comparison of two French forests and variation with heartwood age" ppt
... contrasts with the variation of roburins A and C Roburin A increases in concentration during the first 10 years of ageing and roburin C over the first 30 years, before each declines again in older ... studies (Scalbert et al, 1988; Viriot et al, 1994) allowed the identification of nine of these 12 ellagitannins (fig 1) Purified samples of vescalagin, castalagin, grandinin and roburin A (kindly ... that as well as a general decline in ellagitannins, the individual tannins re- spond differently during ageing Vescalagin, the most abundant ellagitannin in outer heartwood, is seen to decrease...
- 14
- 384
- 0
Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx
... can be anticipated that several clinical trials exploring this approach will be reported in the near future Competing interests Conclusion The available data in animal models and initial data ... factors at various stages of disease, and thus may serve as a sophisticated tool with which to study the relevance of individual chemokines and chemokine receptors in vivo Despite the availability ... inhibiting the migration of cells that are able to produce an array of proinflammatory cytokines at the site of inflammation The identification of the best targets will be the subject of future research...
- 5
- 460
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu