a direct comparison between theory and experiment
Elemental substitution in lead zirconate titanate a combined density functional theory and experimental method
... wide-scale academic and industrial attentions due to their rich functionality and potential applications Lead zirconate titanate has remarkable ferroelectric and piezoelectric effects, which feature ... differential equation In order to make the equation computationally tractable, especially in a system that has many-particles, several approximations are made, and these approximations not affect the ... portable & battery operated systems, contactless smartcards, ID tags and other ultra-low power applications because of FeRAM’s low voltage, low power and fast reading/writing access Sony Playstation...
- 159
- 205
- 0
Ways of greeting and a comparison between vietnamese and english greetings
... Whereas in many countries and in the European continent, handshaking is done when meeting and departing day in and day out and even the same assortment of acquaintances, in England as well as Great ... than men are In Afghanistan, for example, men and women have their own ways of greeting strangers A man will greet by saying manda na bashi (may you not be tired) And a women will raise her hand ... When shaking hands English people shake hands for a few seconds, and they shake hands firmly not loosely A weak handshake is the sign of weak character He "shake hands like a dead fish" refers...
- 37
- 14,227
- 67
Báo cáo khoa học: Structure–activity relation for synthetic phenoxazone drugs Evidence for a direct correlation between DNA binding and pro-apoptotic activity pdf
... transition of calf thymus DNA and its complexes with ActII/ActV determined from DSC measurements All thermodynamic parameters are calculated per mol of DNA base pairs DH and DS, as well as DHbind and DSbind ... Table Binding parameters for ActII/ActV drug–DNA complexation, calculated per mol of ligand at r = 0.33 (ratio of moles of bound ligand to moles of base pairs) Values are mean ± average deviation ... mitoxantrone, ametantrone and its derivatives have shown [9] that variations in the structure –DSbind (calÆmol)1ÆK)1) – DGbind (kcalÆmol)1) ActII–DNA ActIII–DNA ActIV–DNA ActV–DNA Fig Heat absorption...
- 8
- 331
- 0
báo cáo hóa học:" Health-related quality of life in patients waiting for major joint replacement. A comparison between patients and population controls" pot
... improvements in physical function, vitality and mental health and reductions in pain, or have shown that total knee arthroplasty (TKA) and total hip arthroplasty (THA) are beneficial and effective [7-13] ... rheumatoid arthritis, fractures, haemophilia and deformity) as evaluated by the hospital surgeon, a patient aged 16 years or older was placed on the waiting list in a research hospital, and the patient ... from rural area A comparison between patients and population controls showed that controls had more often professional education than patients and patients were heavier than controls Of patients,...
- 7
- 447
- 0
báo cáo hóa học:" Quality of Life as reported by children and parents: a comparison between students and child psychiatric outpatients" ppt
... to several life domains [32] This concept is partly comprised of positive and negative affect as an emotional appraisal of health and life circumstances, as well as an emotional state that is determined ... students matched for sex and age, and that both child and parent proxy reports of QoL were obtained In addition all subjects resided in the same health care Jozefiak et al Health and Quality of ... of Table Outpatients and students matched by age, sex and levels of emotional and behavioural problems Age-group - 9.5 years 10 - 11.5 years 12 - 13.5 years 14 - 15.5 years Total pairs Matched...
- 9
- 494
- 0
Báo cáo lâm nghiệp: "Growth trends reveal the forest structure during Roman and Medieval times in Western Europe: a comparison between archaeological and actual oak ring series (Quercus robur and Quercus petraea)" pot
... stands this average value is mostly higher than the overall growth rate Stands that are managed as high forest display an opposite behaviour Their average radial growth rate and standard deviation ... rates in the first cambial age class (a cambial age of to 10 years, starting from the pith) After they reached an age of ca 20 years the growth rate rapidly decreases, and tends to stabilize at ... basal area is defined as the area of the cross-section of a tree stem near the base, generally measured at breast height The BAI is then defined as the increase in basal area of a tree over a...
- 9
- 405
- 0
Báo cáo khoa học: " Long-term outcome and quality of life of patients treated in surgical intensive care: a comparison between sepsis and trauma" doc
... perform statistical analysis and revised the manuscript critically All authors read and approved the final manuscript 19 20 21 22 Acknowledgements We should like to acknowledge the staff and patients ... surgery and had abdominal sepsis Haraldsen and Andersson [22] retrospectively evaluated long-term outcomes in patients treated in a surgical ICU for abdominal sepsis They reported that most patients ... Table 2) Mean (± standard deviation) EuroQol 5D Index was 0.72 ± 0.24 and did not differ between patients with sepsis and those with trauma One trauma patient described her functional status as...
- 7
- 293
- 0
Báo cáo sinh học: " Modeling relationships between calving traits: a comparison between standard and recursive mixed models" ppt
... maternal genetic effects, sire, and maternal grandsire effects, respectively; s dm and s smgs are the covariances between additive direct and maternal genetic effects and between sire and maternal ... between GL, CD and SB can be found in López de Maturana et al [10] Genetic parameters Additional file 1, Table S1 shows the posterior means (standard deviations) of direct and maternal heritabilities ... exam⎟ e SB ⎟ ⎠ Recursive mixed model (RMM1) and the (co)variance between sire effects of GL and CD, and e GL are the herd-year and residual variances for GL, and hGL hCD and e GL e CD are...
- 9
- 388
- 0
Báo cáo sinh học: "A comparison between Poisson and zero-inflated Poisson regression models with an application to number of black spots in Corriedale sheep" doc
... fibres, an experiment was carried out in which fleeces of animals from two experimental flocks were sampled yearly at shearing for laboratory analysis Each animal was inspected, and the number of black ... parameters) 3.2 Field data Given the simulation results, data were analysed using the two ‘‘best’’ models, Pe and Ze, including flock, year, flock · year and age effect as covariates, and ram as ... discussed by Gianola [15] and used by Rodrigues-Motta and collaborators [27] in an analysis of the number of mastitis cases in dairy cattle 382 H Naya et al From previous exploratory analysis [16,24],...
- 16
- 506
- 0
CFD model of air movement in ventilated façade: comparison between natural and forced air flow
... done including additional simulations and experimental validation cases Mathematical model of the façade Computational fluid dynamics (CFD) research uses computational and mathematical models of ... hydraulic topics She is author and editor of several publications about Hydraulic an Environmental Engineering and Flow Dynamics She has participated in national and international R&D projects and ... theoretical and experimental models as verification and validation of available codes become increasingly important [3] These improvements are related with the ventilation capacity of the additional...
- 12
- 506
- 0
Báo cáo khoa học: Interaction between Lim15/Dmc1 and the homologue of the large subunit of CAF-1 – a molecular link between recombination and chromatin assembly during meiosis pot
... (2001) The Rad51 and Dmc1 recombinases: a non-identical twin relationship Trends Biochem Sci 26, 131–136 Namekawa SH, Iwabata K, Sugawara H, Hamada FN, Koshiyama A, Chiku H, Kamada T & Sakaguchi K ... Koshiyama A, Hamada FN, Namekawa SH, Iwabata K, Sugawara H, Sakamoto A, Ishizaki T & Sakaguchi K (2006) Sumoylation of a meiosis-specific RecA homolog, Lim15/Dmc1, via interaction with the small ... PCR amplification of these cDNAs CcCac1L-N: 1F, 5¢-CGGGATCCA TGTCGGGAGCAGATTCA; 381R, 5¢-TGCTACTTCTC TCAGCGGCCGCATTCTTAT CcCac1L-C: 382F, 5¢-CA TGCCATGGTGTCAGGGGATGTAGAAATG; 812R, 5¢-GAGATTTCAGTTTCGTCACTCGAGCGG...
- 10
- 487
- 0
Báo cáo khoa học: "All Words Domain Adapted WSD: Finding a Middle Ground between Supervision and Unsupervision" pptx
... just 30% of the target data to the source data achieved the same performance as that obtained by taking the entire source and target data Agirre and de Lacalle (2009) reported a 22% error reduction ... Comparing random strategy with oracle based ideal strategy for SemCor to Health adaptation Figure 6: Comparing random strategy with oracle based ideal strategy for SemCor to Tourism adaptation ... Research in Computational Linguistics, pages 19–33 Mitesh Khapra, Sapan Shah, Piyush Kedia, and Pushpak Bhattacharyya 2010 Domain-specific word sense disambiguation combining corpus based and...
- 10
- 337
- 1
Báo cáo khoa học: "Dialect MT: A Case Study between Cantonese and Mandarin" pdf
... from Mandarin than other regions in Mainland China One can easily spot Cantonese dialect articles in Hong Kong newspapers which are totally unintelligible to Mandarin speakers, while Mandarin articles ... J., Tomita M and Goodman K (1992) Machine Translation: A Knowledge-Based Approach Morgan Kaufmann Publishers, San Mateo, California, USA Sinclair J (1991) Corpus, Concordance and Collocation Collins, ... Design and Implementation A rudimentary design of a Cantonese-Mandarin dialect MT system has been made, as shown in Figure The system takes Cantonese Pinyin sentences as input and generates Mandarin...
- 5
- 438
- 0
Báo cáo khoa học: Direct interaction between CD91 and C1q docx
... interaction between CD91 and C1q Evidence for a direct interaction was obtained by surface plasmon resonance (SPR) analysis Using C1q as the soluble analyte and CD91 as the immobilized ligand, ... and without mM calcium; (D) fucoidan; and (E) C1r and C1s After h of incubation, the amount of bound biotinylated CD91 was quantified by incubation with alkaline phosphatase-conjugated streptavidin ... N-hydroxy-succinimidobiotin, a- 2-macroglobulin, exotoxin A, fucoidan, LPS (Pseudomonas aeruginosa) and C1q were obtained from Sigma (St Louis, MO, USA) Alkaline phosphatase-conjugated streptavidin and IgM were obtained...
- 12
- 529
- 0
a course in number theory and cryptography 2 ed - neal koblitz
... Department of Mathematics University of Michigan Ann Arbor, MI 48109 USA Foreword P.R Halmos Department of Mathematics Santa Clara University Santa Clara, CA 95053 USA Mathematics Subject Classifications ... enciphering transformation and make a coded message that inpersonates headquarters and says "CANCEL LAST ORDER!" followed by two blanks and the signature "HEADQUARTERS'.' How many possible affine enciphering ... If a) b and c is any integer, then albc If alb and blc, then alc Ifalbandalc, t h e n a l b f c If p is a prime number and a is a nonnegative integer, then we use the notation pQ(lbto mean that...
- 122
- 1,267
- 0
High speed digital system design a handbook of interconnect theory and design practices john wiley
... system and to calculate trace impedances, propagation velocity, and all self and mutual parasitics The outputs are typically matrices that represent the effective inductance and capacitance values ... effective parasitic inductance and capacitance seen by a single line Since the transmission line parameters vary with data patterns and are essential for accurate timing and signal integrity analysis, ... long and a digital signal with a rise time of 100 ps is to be simulated Given the following inductance and capacitance matrices, calculate the characteristic impedance, the total propagation delay,...
- 327
- 702
- 0
quantum interference and coherence theory and experiments
... Drummond, Bryan s Dalton, Shi-Yao Zhu, Christoph Keitel, Josip Seke, Gerhard Adam, Andrey Soldatov, Joerg Evers, Terry Rudolph and Uzma Akram We are also grateful to Alexander Akulshin, Immanuel Bloch, ... to measure an observable A that is associated with an operator A ˆ has two eigenfunctions |Ψ1 and We assume for simplicity that the operator A |Ψ2 , with corresponding eigenvalues A1 and A2 If ... Fano profiles, laser-induced continuum structures and population trapping in photonic bandgap materials In Chap the theory of subluminal and superluminal propagation of a weak electromagnetic field...
- 427
- 1,335
- 0
challenges to the second law of thermodynamics theory and experiment
... orders of magnitude in size; they are manifest in condensed matter, plasma, gravitational, chemical, and biological physics; they cross classical and quantum mechanical boundaries Several have strong ... V´clav Spiˇka, and William Sheehan Thank you all! a Special thanks are extended to USD Provost Frank Lazarus, USD PresidentEmeritus Alice B Hayes, and Dean Patrick Drinan for their financial support ... to change its state from A to B by an arbitrary process P that is not necessarily quasi-static Heat (HP ) is added by a standard heat source, taken by Macdonald to be a reservoir of water at its...
- 361
- 3,478
- 0
taking shape - a new contract between architecture and nature
... humankind’s expulsion from the Garden Woman was blamed for the Fall, the fall of nature as much as of ‘man’, as what was once gentle and immortal became hostile and ultimately fatal We die, and ... (Plate 6): In the garden we are in the space of nature and culture, form and matter, concrete and abstract, exterior and interior And, significantly, we are in a space of the feminine and the masculine ... to Hyde Park as nature We say certain acts are not ‘natural’, and speak authoritatively about what ‘nature intended’ Ecologists describe an empirically measured nature, and poets and explorers...
- 236
- 485
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008