a different kind of conditional format

13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt

13C–18O bonds in carbonate minerals: A new kind of paleothermometer ppt

Ngày tải lên : 22/03/2014, 18:20
... D47 No (mm) Standard Distance Sr/Ca d13CPDB d18OPDB error (mm) A3 6 A3 5 A3 3 A3 2 A3 1 A2 9 A2 8 A2 7 A2 6 A2 5 A2 4 A2 3 A2 2 A2 1 A1 9 A1 8 A1 7 A1 6 A1 5 A1 4 A1 3 A1 2 A1 0 A9 A8 A7 A6 A5 A4 A2 0.03 0.03 0.03 ... plots all analyses of the NBS-19, MAR-J1, MZ carbonate and Sigma-carb standards made between January, 2004 and April, 2005 Each data point represents the average of between and 10 analyses of the ... temperature of calcite precipitation and the D47 value carbon dioxide extracted from that calcite A least-square Average Standard error Calcite HA2 23 ± À7.54 Average Standard error Calcite HA7 Average...
  • 18
  • 472
  • 0
A Different Story of the History of Western Music and the Aesthetic Project pdf

A Different Story of the History of Western Music and the Aesthetic Project pdf

Ngày tải lên : 23/03/2014, 13:20
... Haydn sonata can a lot But in this type of music always lies a great deal that is vague, ambiguous, uncertain, and you have to have a certain amount of training to get true pleasure from it (as ... characterized by a hegemony of surface aesthetics where the prevalence of an “always-acting” aesthetic results in the “always-aesthetic experience” of aeV This has happened at the same time as ... musical depiction of an illusion of the noumenal world, his social status was very low The time of Plato and Aristotle was a time of dramatic social protests, upheavals and wars that led to serious...
  • 25
  • 644
  • 0
backpacking a different way of camping

backpacking a different way of camping

Ngày tải lên : 02/04/2014, 18:00
... car camping cannot The most beautiful sights are seen while backpacking, and this is because a car can only take one so far Most backpackers experience something that most car campers will ... most car campers will never see: the beauty of nature untouched by common man Regardless of the mode of exploring the great outdoors, an exciting adventure awaits ...
  • 2
  • 276
  • 0
Stephen Wolfram - A New Kind Of Science Episode 12 doc

Stephen Wolfram - A New Kind Of Science Episode 12 doc

Ngày tải lên : 12/08/2014, 08:20
... output of my early cellular automata, 19 Linear algebra and CA invariances, 1022, 1023 and dimensions of networks, 1031 and models of memory, 1101 Linear cellular automata see also Additive cellular ... in nature, 1185 Karatsuba, Anatolii A (Russia, 1937- ) and multiplication, 1142 Kardar-Parisi-Zhang (KPZ) equation, 925 Kari, Jarkko J (Finland/USA, 1964- ) and undecidability in 2D cellular automata, ... cellular automata, 1023 of digits in rationals, 912 of finite-size CAs, 260 for linear congruential generators, 974 longest in cellular automata, 1088 maximal in CAs, 951 for mobile automata, 887 and...
  • 62
  • 432
  • 0
A qualitative analysis of stepfamily formation in singapore

A qualitative analysis of stepfamily formation in singapore

Ngày tải lên : 26/09/2015, 09:47
... Rena Sivadas, counselor at Asian Women’s Welfare Association Family Service Centre and Che Idah Kasmin, social worker at As Salaam, Young Women Muslim Association Family Support Centre for the assistance ... TIME magazine April 2004 Another increase observable in recent years is that of remarriage figures In the past, the main cause for remarriage was the death of a spouse Today, the main cause is ... women had remarried, some data was also generated about their experience of remarriage The study reported that social sanction against divorce and remarriage was strong and the traditional forces...
  • 196
  • 418
  • 0
A study of english vietnamese translation of conditional sentences

A study of english vietnamese translation of conditional sentences

Ngày tải lên : 26/11/2013, 13:27
... replace a written message and/or LITERATURE REVIEW statement in one language by the same message of textual material AND THEORETICAL BACKGROUND in one language into another language in the way that ... Vietnamese – English materials B.Hatim and I.Mason (1989) analyzed the relation between translation and other factors that are related to translating process such as context, structures and pragmatics ... semantic translation is also quite popular In this case, conditional clauses can Usually, the translation of zero conditional sentences is often be translated as “ N u, ng nh , n u nh mà, n u may...
  • 13
  • 2.1K
  • 6
Tài liệu HOW TO HANDLE DIFFERENT TYPES OF RETAIL SHOPPERS AND MAKE SHOPPING A MEMORABLE EXPERIENCE FOR THEM pdf

Tài liệu HOW TO HANDLE DIFFERENT TYPES OF RETAIL SHOPPERS AND MAKE SHOPPING A MEMORABLE EXPERIENCE FOR THEM pdf

Ngày tải lên : 19/02/2014, 10:20
... major advantage such customers offer to a sales person is „their inability to decide‟, a sales person can get a cue of such customer from the way they roam around the store with a weary or amazed ... humble and patient to listen to their knowledgeable views Therefore instead of you doing the talking, let them speak and as soon as you get a cue that they are aware about the product/brand and are ... like management, retailing is also an art as well as science While the scientific back support comes from the way a store is administered and its financial soundness whereas the art of retailing...
  • 9
  • 417
  • 0
Tài liệu Orthodontists and patient´s aesthetic perception to different types of profi les modifi ed by a computer program pdf

Tài liệu Orthodontists and patient´s aesthetic perception to different types of profi les modifi ed by a computer program pdf

Ngày tải lên : 19/02/2014, 17:20
... with Class I or normal cephalometric values Using Dolphin Imaging and Graphics ® lateral cephalograms of subjects in natural posture were scanned Lateral cephalogram and profile images of each subject ... generate another manipulated images In these created images, hard tissue normal values were altered in at least two standard deviations Facial profile images were digitally manipulated in the anterior-posterior ... growth of upper and lower jaw variations, as well as a bi-maxillary protrusive profile typical of Mexican subjects, and bi-maxillary retruded profile representing the typical straight profile in Caucasian...
  • 7
  • 708
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Ngày tải lên : 19/02/2014, 17:20
... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...
  • 12
  • 616
  • 0
Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc

Báo cáo khoa học: Assessment of porcine and human 16-ene-synthase, a third activity of P450c17, in the formation of an androstenol precursor doc

Ngày tải lên : 08/03/2014, 08:20
... performed transfection assays with increasing amounts of DNA fragments encoding cyt b5 and monitored the formation of androstadienol and DHEA As shown in Fig the stimulation of DHEA and androstadienol ... porcine and human assays using preg as a substrate, an additional peak of elution appeared at 15 (panels C and D, respectively) This additional peak coincides with the elution time of nonlabeled ... a more profound effect on the synthesis of androstadienol More precisely, an increase of androstadienol formation was observed at a cyt b5/P450c17 ratio of : (Fig 5) The activity reached a maximum...
  • 7
  • 612
  • 0
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Ngày tải lên : 16/03/2014, 00:20
... 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA TATAAAAAC-3¢ (reverse) The pET151 HP1287 plasmid was amplified using PfuTurbo DNA polymerase and incubated with DpnI to digest the template plasmid Mutated ... QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and ... protease aprE, at the transcriptional level [6] and, for that reason, TenA is often classified as ‘putative transcriptional regulator’ (http:// au.expasy.org/) A comparative analysis of several fully...
  • 9
  • 491
  • 0
Being Born Under Adverse Economic Conditions Leads to a Higher Cardiovascular Mortality Rate Later in Life: Evidence Based on Individuals Born at Different Stages of the Business Cycle pdf

Being Born Under Adverse Economic Conditions Leads to a Higher Cardiovascular Mortality Rate Later in Life: Evidence Based on Individuals Born at Different Stages of the Business Cycle pdf

Ngày tải lên : 17/03/2014, 08:20
... additional macro indicators We consider national annual time-series data of yearly averages, and we include their transitory (detrended) values as additional explanatory variables in the duration analyses ... These may capture a separate long-run effect of nutrition and a separate long-run effect of sanitation and health care In any case, these effects are smaller than half of the effect for areas where ... Amsterdam De Boelelaan 1105 1081 HV Amsterdam The Netherlands E-mail: gjvdberg@xs4all.nl * We thank Angus Deaton, Hans Christian Johansen, Adriana Lleras-Muney, Bernard van Praag, Andreas Wienke, and...
  • 45
  • 453
  • 0
Báo cáo Y học: The presence of phosphate at a catalytic site suppresses the formation of the MgADP-inhibited form of F1-ATPase potx

Báo cáo Y học: The presence of phosphate at a catalytic site suppresses the formation of the MgADP-inhibited form of F1-ATPase potx

Ngày tải lên : 24/03/2014, 00:21
... which are in the normal range for thermophilic F1-ATPase activity ATP hydrolysis assay ATP hydrolysis was measured using an ATP-regenerating system as a decrease in A3 40 of NADH at 25 °C The assay ... of azide on regulation of the chloroplast H+-ATPase by ADP and phosphate Biochim Biophys Acta 973, 7±12 Yalamova, M.V., Vasilyeva, E .A & Vinogradov, A. D (1982) Mutually dependent in¯uence of ADP ... that sulfate, which is an analog of phosphate, indeed Ó FEBS 2002 binds near the c phosphate position of ATP at a catalytic site [38] As previously proposed [18], the presence of Pi at a catalytic...
  • 8
  • 443
  • 0