a convening power to boost the availability of trade finance

Improving the availability of trade finance

Improving the availability of trade finance

Ngày tải lên : 11/04/2015, 12:59
... 10 CHART 1: STOCKS OF TOTAL TRADE FINANCE IN SELECTED EAST ASIAN AND LATIN AMERICAN COUNTRIES ANNEX TABLE I: DATA ON STOCKS OF TOTAL TRADE FINANCE IN SELECTED EAST ASIAN AND LATIN AMERICAN COUNTRIES ... whether it should have a longer-term horizon III A THE WTO AND TRADE FINANCING AREAS OF POTENTIAL ACTION OF THE WTO At first sight, an examination of the WTO role in the issue of trade finance ... worthwhile for the WTO Working Group on Trade, Debt and Finance, as well as for the ad hoc group of the IMF to have a look at the global state of regulation regarding trade finance Apart from local prudential...
  • 25
  • 333
  • 0
A computational study to investigate the effects of insulation and EGR in a diesel engine

A computational study to investigate the effects of insulation and EGR in a diesel engine

Ngày tải lên : 05/09/2013, 16:11
... Transactions, vol 92, 1983, p 3.1086 [29] Arash Nemati, Shahram Khalilarya, Samad Jafarmadar, Hassan Khatamnejhad, Vahid Fathi Numerical parametric investigation of a gasoline fuelled partially-premixed ... temperature regions for baseline and adiabatic with EGR cases are the same Also at adiabatic case for 400°CA and 420°CA, these regions more spread out in the main chamber and the values of local ... working as a faculty in the department of Mechanical Engineering at Jubail University, Jubail, Saudi Arabia He also worked as a Professor and Head of department in the Department of Mechanical Engineering,...
  • 20
  • 643
  • 0
Ocean Acidification: A National Strategy to Meet the Challenges of a Changing Ocean docx

Ocean Acidification: A National Strategy to Meet the Challenges of a Changing Ocean docx

Ngày tải lên : 15/03/2014, 15:20
... existing data management offices and databases that could support ocean acidification observational and research data The FOARAM Act also calls for an “Ocean Acidification Information Exchange” that ... surface waters has already been observed in the Canada Basin of the Arctic Ocean (Bates et al., 2009; Yamamoto-Kawai et al., 2009) Persistent undersaturation of surface waters with respect to aragonite ... delineates ambitious priorities and goals for the National Ocean Acidification Program The FOARAM Act calls for the development of a detailed, 10-year strategic plan for the National Ocean Acidification...
  • 163
  • 400
  • 0
The Weapons Mix Problem - A Math Model to Quantify the Effects of Internetting of Fires to the Future Force pptx

The Weapons Mix Problem - A Math Model to Quantify the Effects of Internetting of Fires to the Future Force pptx

Ngày tải lên : 23/03/2014, 02:20
... The IOF Allocator as Part of a Suite of Analytical Tools xii Internetting of Fires Is the Dynamic Pooling of Resources Enabled by C4ISR The IOF Allocator as Part of the WMT Suite of Analytical ... brought into a variety of programs for analysis The details and full description of the mathematical model at the heart of the IOF Allocator and its implementation are included in Appendixes A and ... preventing the shooters from attacking dead targets (which also may lead to an overestimation of the damage to targeted systems) This too was not a limitation to the IOF Allocator but rather of the...
  • 48
  • 369
  • 0
Báo cáo hóa học: " A Proxy Architecture to Enhance the Performance of WAP 2.0 by Data Compression" ppt

Báo cáo hóa học: " A Proxy Architecture to Enhance the Performance of WAP 2.0 by Data Compression" ppt

Ngày tải lên : 23/06/2014, 00:20
... simulator and injecting traffic from the simulator into the live network after the traffic has been subject to appropriate delays and losses Due to the header added in ns-2 emulation, the Ethernet maximum ... configurations are evaluated by comparing the ATDiffs, which are the WATs of other configurations minus the WAT of uncompressed WAP 2.0 ATDiff = ATotherconf − ATnocomp WAP = WATotherconf − WATnocomp WAP 3.3 ... Telecommunications Engineering, and Associate Head for Graduate A airs His research interests are in the areas of architectural and protocol design and performance analysis for computer and telecommunication...
  • 10
  • 432
  • 0
Báo cáo khoa học: "NaCl plus chitosan as a dietary salt to prevent the development of hypertension in spontaneously hypertensive rats" ppt

Báo cáo khoa học: "NaCl plus chitosan as a dietary salt to prevent the development of hypertension in spontaneously hypertensive rats" ppt

Ngày tải lên : 07/08/2014, 23:22
... NaCl plus chitosan compared to NaCl alone The serum + + electrolyte concentrations of Na and K were identical across all groups On the other hand, the BUN levels of the NaCl plus chitosan-treated ... Kannel WB Blood pressure as a cardiovascular risk factor: prevention and treatment JAMA 1996, 275, 1571-1576 13 Kim D, Yokozawa T, Hattori M, Kadota S, Namba T Effects of aqueous extracts of Apocynum ... pellet diet (Purina Rodent Laboratory Chow; Ralston Purina, USA) were given ad libitum The rats were acclimatized for days prior to the start of the experiments and randomly allocated to five groups...
  • 6
  • 406
  • 1
Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx

Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx

Ngày tải lên : 09/08/2014, 04:21
... Thai BL, Takayasu K, Takayama T, Kosuge T, Gunvén P, Yamazaki S, Hasegawa H, Ozaki H: Preoperative portal embolization to increase safety of major hepatectomy for hilar bile duct carcinoma: a ... Muto T, Ikari T, Yanagisawa A, Kato Y: Proliferative activity of intrahepatic colorectal metastases after preoperative hemihepatic portal vein embolization Hepatology 2001, 34:267-272 Wakabayashi ... Matsuyama Y, Nakayama A, Miyagawa S, Makuuchi M, Kawasaki S: Preoperative portal vein embolization: an audit of 84 patients Hepatology 1999, 29:1099-1105 Page of (page number not for citation...
  • 7
  • 384
  • 0
Báo cáo khoa học: "A pilot study to assess the feasibility of evaluation of markers of response to chemotherapy at one day & 21 days after first cycle of chemotherapy in carcinoma of breast: a prospective non-randomized observational study" potx

Báo cáo khoa học: "A pilot study to assess the feasibility of evaluation of markers of response to chemotherapy at one day & 21 days after first cycle of chemotherapy in carcinoma of breast: a prospective non-randomized observational study" potx

Ngày tải lên : 09/08/2014, 04:21
... had a plateau to nearly same level at 21 days (Figure 2c) Caspase-3 values peaked at 24–48 hours before falling to near baseline levels at 21 days after the first chemotherapy with nearly similar ... significant (p = ns) We faced problems using Caspase-3 to evaluate the apoptotic index, as this terminal enzyme of the apoptotic cascade is cytoplasmic in location This led to a diffuse staining of ... to travel great distances to seek medical care We chose to evaluate three biomarkers, namely Ki-67 (marker of proliferation), Bcl-2 and Caspase-3 (anti- and pro-apoptotic markers) as data exist...
  • 11
  • 393
  • 0
Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx

Báo cáo y học: "A novel approach to measure the contribution of matrix metalloproteinase in the overall net proteolytic activity present in synovial fluids of patients with arthritis" pptx

Ngày tải lên : 09/08/2014, 08:22
... of the MMP family is the hallmark of several inflammatory disorders, including arthritis MMP-9, in particular, has been implicated in the degradation and damage of articular cartilage in RA and ... metalloproteinase (96-kd gelatinase B) in human rheumatoid arthritis Arthritis Rheum 1996, 39:1576-1587 Yoshihara Y, Nakamura H, Obata K, Yamada H, Hayakawa T, Fujikawa K, Okada Y: Matrix metalloproteinases ... La Fondation Armand-Frappier and the Canadian Arthritis Network 16 17 References Momohara S, Kashiwazaki S, Inoue K, Saito S, Nakagawa T: Elastase from polymorphonuclear leukocyte in articular...
  • 10
  • 494
  • 0
Báo cáo y học: "A new approach to understanding the impact of circadian disruption on human health'''' pps

Báo cáo y học: "A new approach to understanding the impact of circadian disruption on human health'''' pps

Ngày tải lên : 10/08/2014, 09:20
... occur at nearly the same time The angular direction of a phasor indicates the phase relationship between light and activity for an individual Greater amounts of activity near the onset of circadian ... indicate prolonged times of rest and, usually, darkness Although many analyses of the activity and of the transformed CS data are possible, the data in Figure were used to develop a quantitative ... perhaps reflecting a true continuum of the degree of circadian behavioral-entrainment among individuals The data from the rats in Figure 9b also show a clear and statistically significant separation,...
  • 14
  • 522
  • 0
báo cáo khoa học: " A randomized trial to assess the impact of opinion leader endorsed evidence summaries on the use of secondary prevention strategies in patients with coronary artery disease: the ESP-CAD trial protocol" doc

báo cáo khoa học: " A randomized trial to assess the impact of opinion leader endorsed evidence summaries on the use of secondary prevention strategies in patients with coronary artery disease: the ESP-CAD trial protocol" doc

Ngày tải lên : 11/08/2014, 05:22
... cholesterol; CAD = coronary artery disease; AMI = acute myocardial infarction; ACS = acute coronary syndrome; CV = cardiovascular; Atorva = atorvastatin; Prava = Pravastatin; Simva = simvastatin the EURopean ... atherosclerosis)[81] All of the faxes (APPROACH HeartView diagrams and the one page statement) will be generated and sent automatically using a software program that has been developed for this trial and embedded ... not had a fasting lipid panel done in the six weeks prior to their cardiac catheterization; (2) they are already on a statin at maximal dose; (3) they are on a statin/lipid-lowering drug and the...
  • 12
  • 396
  • 0
Báo cáo y học: " A statistical approach to estimating the strength of cell-cell interactions under the differential adhesion hypothesis" pptx

Báo cáo y học: " A statistical approach to estimating the strength of cell-cell interactions under the differential adhesion hypothesis" pptx

Ngày tải lên : 13/08/2014, 16:21
... models These models are dual to the centric models [15,16], and they have the same characteristics in terms of realism and computational behavior The fourth class of models, called sub-cellular lattice ... configuration obtained after 100,000 iterations with θ = 10 (b) The decrease of the energy as a function of the iteration steps (c) The evolution of the accpetance rate as a function of the iteration steps ... and that white cells may ˆ be surrounded by black cells The estimated value θ was Experimental data Estimation of the adhesion strength was also performed on a real data example We used data from...
  • 13
  • 326
  • 0
LET''''S LEARN ENGLISH WITH A SMILE - HOW TO TELL THE SEX OF A BIRD - PHÂN BIỆT CHIM TRỐNG CHIM MÁI - MẶT TRỜI BÉ CON - TRẦN TIẾN

LET''''S LEARN ENGLISH WITH A SMILE - HOW TO TELL THE SEX OF A BIRD - PHÂN BIỆT CHIM TRỐNG CHIM MÁI - MẶT TRỜI BÉ CON - TRẦN TIẾN

Ngày tải lên : 22/10/2014, 20:00
... HOW TO TELL THE SEX OF A BIRD THIS IS AMAZING !!! Until now I never fully understood how to tell the difference between Male and Female birds I always thought it had to be determined surgically ... now Below are two birds Study them closely See if you can spot which of the two is the Female It can be done Even by one with limited bird watching skills…! Send this to all of the men you ... watching skills…! Send this to all of the men you know, who could with a good laugh, and to all women who have a great sense of humor !!! Collection by FGMLGMU 06/03/2011 ...
  • 4
  • 465
  • 0
TOWARDS a CONSISTENT CHRONOLOGY TO EXPLAIN THE EVOLUTION OF THE RIBOSOME

TOWARDS a CONSISTENT CHRONOLOGY TO EXPLAIN THE EVOLUTION OF THE RIBOSOME

Ngày tải lên : 09/09/2015, 10:17
... first, the twenty specific amino acids specifically attach to the transfer RNA (tRNA) molecules via covalent linkage with the help of aminoacyl-tRNA synthetases (aaRSs), the catalyst of the aminoacylation ... common to archaea and bacteria (Hartman and Smith 2010) In the translational process, the initiation factor in bacteria, IF2, and their archaeal homologs, the EF1, EF2, aeIF5b and aeIF2 bring the ... The aaRSs are multi-domain proteins, in which only one domain works as the catalytic domain, the others are capable of anticodon binding, aaRS-tRNA stabilization and tRNA deacylation Among them,...
  • 199
  • 473
  • 0
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

Ngày tải lên : 24/09/2012, 17:19
... increase the competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand ... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its ... can be generalize to all customer of McDonald and Max hamburger because the sample is small to represent all the actual customer of both restaurant and also the fact that the students lived together...
  • 88
  • 986
  • 8
Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english  a comparison

Refusals to invitations the use of vietnamese learners of english and the use of native speakers of english a comparison

Ngày tải lên : 07/09/2013, 13:31
... situations It was found that the frequency of the use of the speech act of refusal by the Australian NSs of English was different from that by the VLEs Although the VLEs and the Australian NSs of ... Beebe et al (1987), more advanced learners are more affected by the refusal strategies of their native language, whereas the native language of the learners in Yagamashira’s study had more influence ... shift their refusal strategies noticeably according to the status of the interlocutors The above review of the related literature of the speech act of refusal shows that the use of refusal strategies...
  • 44
  • 1.2K
  • 4
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

Ngày tải lên : 20/12/2013, 17:15
... have the help of sophisticated information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar to ... and other parameters related to the customer, whereas the role of the employees, their satisfaction, loyalty and the link between these variables and profitability is not often included in marketing...
  • 15
  • 796
  • 0
Evaluating the availability of electrical substations  a dynamic methodology

Evaluating the availability of electrical substations a dynamic methodology

Ngày tải lên : 03/01/2014, 19:36
... component availability states This approach permits the representation of all availability states of a system and rhe incorporation of functional aspects: loss of a function is identified by the occurrence ... incorporated To this, the real state of the substation for each state in the path is evaluated taking into account the operation of protection devices In the above example, the substation’s real state ... state j of generic state i path k leading to specific state j of generic state i real availability state of the substation following activation of the protection system for state Aij and path Aijk...
  • 10
  • 243
  • 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

Ngày tải lên : 14/02/2014, 22:20
... Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase on whole plant carbon metabolism ... Experimental procedures, the rate of assimilate export from photosynthetically active source organs to consuming sink organs or metabolic pathways other than carbohydrate pathways was calculated as the ... reprogramming of central carbohydrate metabolism Mathematical modelling of metabolism with respect to the dynamics of freezing tolerance revealed a significant correlation of sucrose synthesis and...
  • 13
  • 707
  • 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Ngày tải lên : 19/02/2014, 17:20
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR ... equal amounts of formate and acetyl-CoA and the resulting acetyl-CoA is then metabolized into equal amount of ethanol and acetate to maintain the redox balance Discussion In this study we quantified ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products were digested with XhoI ⁄ BamHI and BamHI ⁄ XbaI, respectively, and cloned...
  • 12
  • 616
  • 0