a common platform to move forward on greening our economies and growth processes

Báo cáo toán học: " A new approach to investigate the interactions between sediment transport and ecotoxicological processes during flood events" ppt

Báo cáo toán học: " A new approach to investigate the interactions between sediment transport and ecotoxicological processes during flood events" ppt

Ngày tải lên : 20/06/2014, 21:20
... SR, AS and HH contributed equally to the content of the article and gave their final approval All authors read and approved the final manuscript Competing interests The authors declare that they ... biochemical markers (7ethoxyresorufin-O-deethylase, glutathione-S-transferase and catalase activity, lipid peroxidation), gene expression analyses (quantitative real-time RT-PCR), determination of cytochrome ... components, storage time of the sediment, and presence or absence of fish Furthermore, the water content, the capacity of exchangeable cations, the organic matter and additional variables are...
  • 5
  • 435
  • 0
báo cáo hóa học:" Development and evaluation of a clinical algorithm to monitor patients on antiretrovirals in resource-limited settings using adherence, clinical and CD4 cell count criteria" ppt

báo cáo hóa học:" Development and evaluation of a clinical algorithm to monitor patients on antiretrovirals in resource-limited settings using adherence, clinical and CD4 cell count criteria" ppt

Ngày tải lên : 20/06/2014, 08:20
... http://www.jiasociety.org/content/12/1/3 Table 1: Univariate analysis of variables associated with viral failure in 496 Ugandans on ART at the Infectious Diseases Institute, Kampala, Uganda Variable Total Undetectable viral load N ... oversight and conduct and manuscript writing LS and LJ performed data analysis and contributed to manuscript writing RD performed laboratory analyses and contributed to manuscript writing HT, SM and ... Figure Kampala, Uganda 496 clinical algorithms to monitor for viral failure (VF) in TwoUgandans on ART at the Infectious Diseases Institute in Two clinical algorithms to monitor for viral failure...
  • 10
  • 533
  • 0
báo cáo khoa học: "A trial platform to develop a tailored theory-based intervention to improve professional practice in the disclosure of a diagnosis of dementia: Study protocol [ISRCTN15871014]" potx

báo cáo khoa học: "A trial platform to develop a tailored theory-based intervention to improve professional practice in the disclosure of a diagnosis of dementia: Study protocol [ISRCTN15871014]" potx

Ngày tải lên : 11/08/2014, 05:22
... allow calculation of response rates and sample representativeness), and send reminders and financial incentives to those who have opted in (so as to enhance our response rate) Sample size and analysis ... theoretical constructs and clinical discipline) and outcome measures (behavioural intention and simulation) will be assessed primarily using multiple regression analysis and structural equation modelling ... elements of an intervention are manipulated within a randomised controlled design in a manner that simulates a real situation as much as possible Interim endpoints (stated behavioural intention and simulation)...
  • 6
  • 334
  • 0
Using a Spend Analysis to Help Identify Prospective Air Force Purchasing and Supply Management Initiatives - Summary of Selected Findings potx

Using a Spend Analysis to Help Identify Prospective Air Force Purchasing and Supply Management Initiatives - Summary of Selected Findings potx

Ngày tải lên : 06/03/2014, 16:20
... data sources; gathering and integrating additional data on suppliers, markets, internal Air Force requirements, and market factors; maintaining substantial computational capability and experts to ... They also continually manage suppliers and the supply base In sum, a spend analysis integrates internal spend data and external supplier and market data and applies analytical and benchmarking ... Development; Manpower, Personnel, and Training; Resource Management; and Strategy and Doctrine Additional information about PAF is available on our web site at http://www.rand.org/paf v CONTENTS Preface...
  • 105
  • 394
  • 0
Báo cáo khoa học: A modelling approach to quantify dynamic crosstalk between the pheromone and the starvation pathway in baker’s yeast pot

Báo cáo khoa học: A modelling approach to quantify dynamic crosstalk between the pheromone and the starvation pathway in baker’s yeast pot

Ngày tải lên : 30/03/2014, 10:20
... knowledge about the wiring of the pheromone pathway and the filamentous growth pathway in yeast We concentrated on the main dynamic features and the interconnections between the two pathways and on a ... crosstalk measures We assume that a signalling pathway has certain targets it activates and that each target can be assigned a specific or intrinsic stimulus and signal, whose major target it is, and ... the model was tested by a qualitative comparison of the model results to available data Three so-called standard runs were employed: (a) only application of a factor, (b) only application of b stimulus,...
  • 14
  • 395
  • 0
Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx

Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx

Ngày tải lên : 31/03/2014, 04:20
... (non-spontaneous voicing) and N (nasality), and the resonance elements A (low), I (palatal), U (labial) and R (coronal) These elements are phonologically active - they can spread to neighbouring segments, ... standard relational database tools for control of the lexicon and standard code for FFT as in a spectrogram display object Users may add words using a keypad labelled with IPA symbols Manner class sequences ... manner class alone This is the case for languages such as English, German, French and Italian, so the accessing of an individual word may be successful as early as Stage 1, and no further data...
  • 5
  • 337
  • 0
Báo cáo hóa học: " Research Article A Novel Image Compression Method Based on Classified Energy and Pattern Building Blocks Umit Guz" ppt

Báo cáo hóa học: " Research Article A Novel Image Compression Method Based on Classified Energy and Pattern Building Blocks Umit Guz" ppt

Ngày tải lên : 21/06/2014, 05:20
... order to decorrelate the data in the least mean square (LMS) sense among all linear orthogonal transforms PCA is a linear orthogonal transform from an m-dimensional space to p-dimensional space, ... has become a standard method in the image compression applications In the wavelet compression, the image data is transformed and compressed as a single data object rather than block by block as ... Electronics, vol 48, no 3, pp 682–695, 2001 [48] Z Xiong, K Ramchandran, M T Orchard, and YA Q Zhang, A comparative study of DCT- and wavelet-based image coding,” IEEE Transactions on Circuits and...
  • 20
  • 439
  • 0
Using a record sorfware to promote High school students' English listening and speaking skills = Sử dụng phần mềm ghi âm để phát triển kỹ năng nghe và nói tiếng

Using a record sorfware to promote High school students' English listening and speaking skills = Sử dụng phần mềm ghi âm để phát triển kỹ năng nghe và nói tiếng

Ngày tải lên : 30/03/2015, 14:31
... communication and authentic interaction; expanding topic beyond classroom-based ones; promoting student-centered language learning; encouraging equal opportunity participation and connecting speakers ... in clear bureau of tables and charts After rate calculation, the data was tested and analyzed with the t-test to measure the students‟ progress A p-value of 0.05 (see Data Statistic Mathematics, ... televisions, etc… has considerably changed the classroom structures, and approaches to learning and teaching including second and/ or foreign language learning and teaching For example, OHPs can help...
  • 60
  • 1.1K
  • 1
A CLOSER LOOK TO SOUTHEAST ASIAN FINANCIAL CRISIS  IN 1997 AND THE LESSONS FOR VIETNAM  International Finance

A CLOSER LOOK TO SOUTHEAST ASIAN FINANCIAL CRISIS IN 1997 AND THE LESSONS FOR VIETNAM International Finance

Ngày tải lên : 30/03/2016, 23:56
... occurring and consequences of the East Asian crisis on several Southeast Asian countries including Thailand Malaysia, Indonesia, Philippines along with Korea and Hong 3|Page Kong This part also analyses ... development and social sustainability at the national, regional and international as an organic whole The process of liberalization and globalization will be pushed to a new step, in part because of ... information to the public) - Maintain financial market stability (established Danahata Bank debt management and Danamodal recapitalization and debt restructuring committee business) - Strengthen national...
  • 34
  • 609
  • 3
Tài liệu Unionization and Economic Performance: Evidence on Productivity, Profits, Investment, and Growth docx

Tài liệu Unionization and Economic Performance: Evidence on Productivity, Profits, Investment, and Growth docx

Ngày tải lên : 21/02/2014, 00:20
... workplace and in relations between labor and management For example, Weiler (1990) and others have argued that changes in National Labor Relations Board’s interpretation of American labor law, ... Industrial and Labor Relations Review 47 (January): 302-18 Hirsch, Barry T., and Kislaya Prasad 1995 "Wage-Employment Determination and a Union Tax on Capital: Can Theory and Evidence Be Reconciled? ... labor market and the presence of firm’s quasi-rents Stated alternatively, wage increases to unions are in part a tax on capital and need not lead firms to shift their factor mix away from labor...
  • 34
  • 431
  • 0
Báo cáo lâm nghiệp: "Effects of elevated carbon dioxide on leaf gas exchange and growth of cork-oak (Quercus suber L) seedlings " pps

Báo cáo lâm nghiệp: "Effects of elevated carbon dioxide on leaf gas exchange and growth of cork-oak (Quercus suber L) seedlings " pps

Ngày tải lên : 08/08/2014, 18:21
... leads to a greater initial growth rate and to a greater total leaf area (Gaudillère and Mousseau, 1989) which could promote a large difference of biomass production at the plant level ACKNOWLEDGMENTS ... treatments (fig 3) This difference disappeared at months The ratio of secondary stem mass to total stem mass and the ratio of non-fully expanded leaves to total leaf biomass were significantly ... changes of maximal photosynthesis and stomatal conductance versus predawn leaf water potential Under wellwatered conditions, whatever the CO par2 tial pressure, maximal net photosynthesis and...
  • 7
  • 240
  • 0
A role for chondroitin sulfate proteoglycan in regulating the survival and growth of neural stem cells

A role for chondroitin sulfate proteoglycan in regulating the survival and growth of neural stem cells

Ngày tải lên : 12/09/2015, 21:26
... Ramachandran A, Poonepalli A, Yu YH, Ahmed S Chondroitin sulfate proteoglycan stimulates neural stem cell survival via EGFR signalling pathways Manuscript in preparation • Ahmed S, Gan H, Lam ... to oncogenesis Mutations of these pathways have been associated with a number of human tumours, including colon carcinoma and epidermal tumours (Wnt), medulloblastoma and basal cell carcinoma ... 46-48 Abstracts: • Tham AVM and Ahmed S CSPG is essential for neural stem cell survival and proliferation, for neurosphere formation and maintenance 6th Asia Pacific Symposium on Neuroregeneration...
  • 226
  • 590
  • 0
Vcd as a stimulating factor to increase the young learners’ time-on-task

Vcd as a stimulating factor to increase the young learners’ time-on-task

Ngày tải lên : 07/11/2012, 14:44
... and on functional models of language The language functions and language notions are taught to learners at the same time with the assumption that language learning relates to learning formulaic ... creation and maintenance of interpersonal and social relations between individuals, and learners are viewed as language users It is an attempt for implementation of the analytic syllabus, which aims ... teaching and learning are illustrated with examples from a wide range of material, at all levels of language learning Radio and television have made important contribution to foreign language learning...
  • 45
  • 516
  • 0
A STUDY ON UNREAL CONDITIONAL SENTENCES AND WAYS TO TRASLATE THEM INTO VIETNAMESE

A STUDY ON UNREAL CONDITIONAL SENTENCES AND WAYS TO TRASLATE THEM INTO VIETNAMESE

Ngày tải lên : 11/12/2013, 23:57
... Word-for-word translation Literal translation Faithful translation Semantic translation TL emphasis Adaptation free translation Idiomatic translation Communicative translation Word-for-word translation The ... UNREAL CONDITIONALS INTO VIETNAMESE I Translation of unreal conditionals in the present II Translation of unreal conditionals in the past III Translation of Conditional inversions IV Translation ... original A semantic translation has to interpret; a communicative translation has to explain Communicative translation allows the translator no more freedom than semantic translation Indeed, translation...
  • 65
  • 693
  • 1
Tài liệu A Quick Guide To Common Childhood Diseases pptx

Tài liệu A Quick Guide To Common Childhood Diseases pptx

Ngày tải lên : 12/02/2014, 11:20
... Health and Welfare Canada (2006) Canadian Immunization Guide (7th ed.) Ottawa, On: Health and Welfare Canada Available at: http://www.phac-aspc.gc.ca/naci-ccni/index-eng.php and http://www.phac-aspc.gc.ca/naci-ccni/index-eng.php ... there are no symptoms Signs and symptoms of giardiasis may include: Diarrhea (may have a bad smell or greasy appearance) Abdominal cramps Bloating and gas Fatigue Loss of appetite and nausea How ... after playing at the water table After playing outside or in the sandbox After handling animals or animal waste How to Wash Your Hands Use regular soap that does not contain antibacterial agents...
  • 48
  • 406
  • 0
Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Tài liệu University Oars Being a Critical Enquiry Into the After Health of the Men Who Rowed in the Oxford and Cambridge Boat-Race, from the Year 1829 to 1869, Based on the Personal Experience of the Rowers Themselves pdf

Ngày tải lên : 14/02/2014, 21:20
... which has gone on to dilatation and its consequences Nevertheless, in the absence of any statistics to the contrary, I strongly suspect that I am an exceptional case, and my aquatic career was not ... blazoned forth to point a moral or adorn a tale The men also who engage in that contest belong to a class who, from their position, may reasonably be expected to shape their habits agreeably to ... learning, and discovery, its contributions to national and global politics and culture, and its inevitable controversies and scandals University Oars University Oars is a compilation of letters...
  • 419
  • 541
  • 0
Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc

Tài liệu Báo cáo khoa học: PC1⁄3, PC2 and PC5⁄6A are targeted to dense core secretory granules by a common mechanism doc

Ngày tải lên : 18/02/2014, 16:20
... J D Dikeakos et al is autocatalytically cleaved, a central catalytic domain comprising the catalytic triad of amino acids aspartic acid, histidine and serine, and a stabilizing P-domain involved ... Dhanvantari S, Arnaoutova I, Snell CR, Steinbach PJ, Hammond K, Caputo GA, London E & Loh YP (2002) Carboxypeptidase E, a prohormone sorting receptor, is anchored to secretory granules via a ... C-terminal transmembrane insertion Biochemistry 41, 52–60 Garcia AL, Han SK, Janssen WG, Khaing ZZ, Ito T, Glucksman MJ, Benson DL & Salton SR (2005) A prohormone convertase cleavage site within a...
  • 9
  • 600
  • 0
Tài liệu Báo cáo khoa học: The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression ppt

Tài liệu Báo cáo khoa học: The RNA recognition motif, a plastic RNA-binding platform to regulate post-transcriptional gene expression ppt

Ngày tải lên : 19/02/2014, 17:20
... clear why these RRM domains that are very similar to the classical ones favor interaction with proteins rather than RNA Conclusion and perspectives The RNA recognition motif is an abundant and ... involving one RRM domain and another domain In some cases, it has been demonstrated that RRMcontaining proteins can associate with RNA only in the presence of another protein that acts as a cofactor ... interaction in addition to RNA binding In most of these complexes, these additional interactions contribute to the formation of a larger RNA-binding interface and are therefore critical to reach...
  • 14
  • 428
  • 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Ngày tải lên : 07/03/2014, 09:20
... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards...
  • 11
  • 731
  • 0